پایان نامه ارشد درباره of، 107BF.experimental.construct، 107bf.teoretiical.construct، and

دانلود پایان نامه ارشد

92bf.teoretical.construct CATTAAATAGTCAAGCTT——————————– 780

CLUSTAL 2.1 multiple sequence alignment

********* ***********. ****************.*******.**

****** *******************************************

* ************************************* **********




**********************.: .**** * *** * *.**.**

. .*… **.* **.:.* ::** .*…..*** :**..*

*.**:** .***:**. * **.****: *: *.:*:..*. **::..

**. .:**.*. * *** * *.**.** . .*… **.* **.:.* :

:** .*…..*** … :*::*.:*…. ***. .:: :*…..:

*:..**: *** * :* *.**.*:***********************




107bf.teoretiical.construct TGTGATTTATAGGCATCATTAAATAGTCAAGCTT—————- 780

شکل ب: سازههای آزمایشگاهی که حاصل کلونینگ طول کامل ژن هیبرید cstH::cbβm در ناقلpBR322 میباشند و صحت کلونینگ آنها در مرحله قبل بوسیله مقاومت آنتیبیوتیکی، برش آنزیمی و واکنش PCR تائید شده بود در این مرحله با استفاده از پرایمر رفت و پرایمر برگشت دو سوی ژن tet تعیین توالی شده و سپس با استفاده از نرمافزار Clustal W با سازه تئوری همتای خود همردیف گردیدند. از آنجائیکه که محل اتصال پرایمر مورد استفاده در دو طرف محل کلونینگ (جایگاه آنزیمی E.coR V) در ناقل میباشد، لذا در تمام موارد دو سوی ژن هیبرید نیز تعینن توالی شده از اینرو ابتدا و انتهای همردیفی دارای شکاف میباشد که تا حد امکان آنها را حذف کردهایم دقت شود سازهها بر اساس محل ورود پپتید متصل شونده به فلز سنگین نامگذاری شدهاند.

In this study, through a combination of bioinformatics and genetic engineering procedures, high-affinity metal binding peptides were designed and expressed on the surface of Escherichia coli for selective Cd2+ adsorption. Putative cadmium binding motifs were identified by searches against the Prosite database and permissive sites in the major subunit (CstH) of the enterotoxigenic Escherichia coli pili were predicted based on the data derived from modeling of 3-D structures, secondary structure prediction and assignment, inspection of protein hydropathy and exposed regions and also protein interaction sites. The metal binding motifs were inserted into permissive sites of the CstH with the aid of SOEing PCR technique. The capacity and selectivity of the recombinant bacteria displaying hybrid pili to adsorb cadmium were evaluated with the atomic absorption procedure. The levels of Cd2+ accumulation in the recombinant E. coli strains were 8 till 16 -fold higher than those in the control strain. Cd2+ was selectively uptaken from a solution containing equal concentrations of four metals, resulting in more than 90% of the total adsorbed metals being Cd2+ for some recombinant E. coli strains, showing a relatively high affinity for Cd2+ over other co-existing metal ions.
Keywords: metal binding motif, cadmium, surface display and bacterial pili

Ministry of Science, Research and Technology
National Institute of Genetic Engineering and Biotechnology

In Biology – Molecular Genetics

(Thesis Title)
In silico design of specific cadmium binding peptide and construction of a bacterial surface display based on CS3 pili for specific removal of cadmium

Vajiheh Eskandari

Dr. Bagher Yakhchali Dr. Mehdi Sadeghi
Dr. Ali Asghar Karkhaneh

February 2013

Ministry of Science, Research and Technology
National Institute of Genetic Engineering and Biotechnology

Ph.D. Thesis
In Biology – Molecular Genetics

In silico design of specific cadmium binding peptide and construction of a bacterial surface display based on CS3 pili for specific removal of cadmium

Vajiheh Eskandari

Dr. Bagher Yakhchali Dr. Mehdi Sadeghi
Dr. Ali Asghar Karkhaneh

February 2013
1 Biochips
2 Biofuel
3 Bioleaching
4 Green Plastics
5 Biomass
6 nanostructures
7 bio transistor
8 Genomics
9 Proteomics
10 Systems biology
11 Computational biology
12 phylogenetic tree
13 Data Base
14 Record
15 National Center for Biotechnology Information
16 Primary Database
17 Secondary Database
18 Site
19 Expert Protein Analysis System
20 European Molecular Biology Laboratory
21 European Bioinformatics Institute
22 Swiss Institute of Bioinformatics
23 Protein Information Resource
24 Identifier
25 Primary Structure
26 Secondary Structure
27 Tertiary Structure
28Forth Structure
29 Assignment Secondary Struture
30 Nuclear magnetic resonance
31 Comparative Modeling
32 Fold Recognation

پایان نامه
Previous Entries پایان نامه ارشد درباره **************************************************، 80bfm.teoritical.construct، 80BFm.experimental.construct، 92BF.experimental.construct Next Entries پایان نامه با کلید واژه های مواد غذایی، پوشش گیاهی، روش نمونهگیری، شرایط آب و هوایی