پایان نامه ارشد درباره Amp، CStH، cstH::cbm، cst

دانلود پایان نامه ارشد

بهترین RMSD را بدست میآورد برای کسب انطباق مطلوب به برنامهنویسی پویا78 ارائه میگردد و نتیجه آن بر حسب امتیاز Z به کاربر ارائه می شود امتیاز Z بالای 3.5 نشاندهنده ساختار مشابه دو مکلول میباشد.
3-2-2 پیشگویی سطوح در دسترس و سطوح مشترک بین دو پروتئین
سطوح در دسترس پروتئین مناطقی را شامل میشوند که میتوانند در دسترس محیط باشند بعبارت دیگر وارد کردن قطعات بیگانه در این مناطق احتمال ارائه آنها را به محیط افزایش میدهد از طرف دیگر سطوح در میانکش پروتئین ها نیز باید شناسایی شوند تا از دستورزی کنار گذاشته شوند. بعبارت بهتر بنابراین در اینگونه مطالعات داشتن هرگونه اطلاعاتی درباره سطح در دسترس و در میانکش میتواند مفید باشد. جهت شناسایی این مناطق از برنامههای Protscale، Vadar،Getarea، Meta-PPISP و همچنین از روش داکینگ ملکولی Cluspro و GRAMM-X استفاده شد.

3-2 مواد
1-3-2 ترکیبات استفادهشده
اتیدیوم بروماید، نیترات سرب، نیترات کادمیم، سولفات نیکل ( از شرکت سیگما)، اتیلن دی آمین تترا استیک اسید (EDTA)، اسید استیک غلیظ، اسید کلریدریک، آگار، آگارز، ایزوپروپانل، 2- بوتانل، کلرید منیزیم، سولفات منیزیم، سولفات مس، سولفات روی، کلرید کلیسم، آمونیم پرسولفات (APS)، استات سدیم، فنل، کلروفرم، گلیسرول، اتانل مطلق، برموفنل بلو، سدیم دودسیل سولفات (SDS)، بتامرکاپتواتانل، کوماسی بلو، تریس اسیدی، آکریل آمید، سدیمآزید، پپتون، آلبومین سرم گاوی (BSA)، (,HRP Horse Radish Peroxidas) (از شرکت مرك آلمان با درجه خلوص بيولوژي مولكولي)، دی اکسی نوکلئوتیدتریفسفات شامل دیاکسیتیمیدینتریفسفات، دیاکسیآدنوزینتریفسفات، دیاکسیسیتوزینتریفسفات، دیاکسیگوانوزینتری فسفات(از شرکت Roche) کازامینواسید (از شرکت Difco)
2-3-2 آنتی بیوتیک ها
آمپیسیلین (amp) با غلظت 100mg/ml، کلرامفنیکل با غلظت 30 mg/ml و تتراسایکلین12.5 mg/ml در فریزر 20- درجه سانتیگراد نگهداری شد.(آنتیبیوتیک هااز شرکت Roche تهیه گردیدند).
3-3-2 آنتی بادیهای اولیه
از آنتیبادی پلی کلونال ضدپیلیCS3 (Rabbit anti CS3) تهیه شده در پژوهشگاه ملی مهندسیژنتیک و زیستفناوری پس از جذب با پروتیئن سطحی باکتری میزبان استفاده گردید.
4-3-2 آنتی بادیهای ثانویه
Goat – anti-rabbit –Immunoglubin horseradish peroxidase conjugate (Roche )
Swine – anti-rabbit IgG fluorescein isothiocyanate(FITC ) conjugate (Dako)
Rabbit – anti mouse IgG fluorescein isothiocyanate(FITC ) conjugate (Dako)
5-3-2 باکتریها
در این تحقیق از باکتری E. coli DH5α، با مشخصات ژنتیکی زیر به منظور تهيه سلولهاي مستعد و همسانه سازی ناقلين پلاسمیدی استفاده شد.
F–, gyrA96 (Nalr) Δ(lacZYA-argF) U169 [ø80dlacZΔM15] deoR, relA1 , recA1,
endA1, hsdR17(rK–, mK+), phoA, supE44, λ–, thi-1.

6-3-2 پلاسمیدها
پلاسميدهايي که در اين تحقيق مورد استفاده قرارگرفته و يا ساخته شدهاند، به همراه ويژگي و منابع تأمين کننده آنها در جدول 2-8 ارائه شدهاست.
جدول 2-8.. مشخصات پلاسمیدهای استفادهشده و یا ساختهشده در این تحقیق
پلاسمید
مارکر
ویژگی
منبع
pBR322

Amp-Tet
وکتور کلونینگ
پژوهشگاه ملی مهندسی ژنتیک
pPM4556
Amp
وکتور pBR322 حامل ژن cstH (زیر واحد اصلی پیلی CS3)
Yakhchali and Manning, 1997
pPM4567
Cm
وکتور pBC حامل کل اپرون cst که برای ساخت و بیان پیلی هیبرید استفاده شد
Yakhchali and Manning, 1997
pEYS38cbm1
Amp
پلاسمید pBR322 دارای موتیف اتصالی به کادمیوم از پروتیئن CadA در جایگاه مجاز موقعیت 38 پروتئین CStH
این تحقیق
pEYS38cbβm1
Amp
پلاسمید pBR322 دارای موتیف تصالی به کادمیوم و زنجیره β همسایه از پروتیئن CadA در جایگاه مجاز موقعیت 38 پروتئین CStH
این تحقیق
pEYS38cbm2
Amp
پلاسمید pBR322 حاوی اپرون cst نوترکیب بیان کننده موتیف اتصالی به کادمیوم در موقعیت 38 پروتئین CStH
این تحقیق
pEYS38cbβm2
Amp
پلاسمید pBR322 حاوی اپرون cst نوترکیب بیانکننده بتا-موتیف اتصالی به کادمیوم در موقعیت 38 پروتئین CStH
این تحقیق
pEYS66cbm1
Amp
پلاسمید pBR322 دارای موتیف اتصالی به کادمیوم از پروتیئن CadA در جایگاه مجاز موقعیت 66 پروتئین CStH
این تحقیق
pEYS66cbm2
Amp
پلاسمید pBR322 حاوی اپرون cst نوترکیب بیانکننده موتیف اتصالی به کادمیوم در موقعیت 66 پروتئین CStH
این تحقیق
pEYS79cbm1
Amp
پلاسمید pBR322 دارای موتیف اتصالی به کادمیوم از پروتیئن cadA در جایگاه مجاز موقعیت 79 پروتئین CStH
این تحقیق
pEYS79cbβm1
Amp
پلاسمید pBR322 دارای موتیف تصالی به کادمیوم و زنجیره β همسایه از پروتیئن CAdA در جایگاه مجاز موقعیت 79 پروتئین CStH
این تحقیق
pEYS79cbm2
Amp
پلاسمید pBR322 حاوی اپرون cst نوترکیب بیانکننده موتیف اتصالی به کادمیوم در موقعیت 79 پروتئین CStH
این تحقیق
pEYS79cbβm2

Amp
پلاسمید pBR322 حاوی اپرون cst نوترکیب بیانکننده بتا-موتیف اتصالی به کادمیوم در موقعیت 79 پروتئین CStH
این تحقیق
pEYS92cbm1
Amp
پلاسمید pBR322 دارای موتیف اتصالی به کادمیوم از پروتیئن cadA در جایگاه مجاز موقعیت 92 پروتئین CStH
این تحقیق
pEYS92cbm2
Amp
پلاسمید pEYS92m1 به همراه ژنهای تنظیمی بیان پیلی CS3از اپرون cst
این تحقیق
pEYS107cbm1
Amp
پلاسمید pBR322 دارای موتیف اتصالی به کادمیوم از پروتیئن CAdA در جایگاه مجاز موقعیت 107 پروتئین CStH
این تحقیق
pEYS107cbβm1
Amp
پلاسمید pBR322 دارای بتا-موتیف اتصالی به پروتیئن CAdA در جایگاه مجاز موقعیت 107 پروتئین CStH
این تحقیق
pEYS107cbm2
Amp
پلاسمید pBR322 حاوی اپرون cst نوترکیب بیان کننده موتیف اتصالی به کادمیوم در موقعیت 107 پروتئین CStH
این تحقیق
pEYS107cbβm2
Amp
پلاسمید pBR322 حاوی اپرون cst نوترکیب بیان کننده بتا-موتیف اتصالی به کادمیوم در موقعیت 79 پروتئین CStH
این تحقیق

7-3-2 اولیگونوکلئوتیدها
به منظور تکثير ژن و ساخت سازوارههاي مورد نياز در اين تحقيق از اوليگونوکلئوتيدهای ليست شده در جدول 2-9 استفاده شد.
جدول 2-9. مشخصات اوليگونوکلئوتيدهای استفادهشده در اين تحقيق
کاربرد
توالی
نام پرایمر
تکثیر ژن cstH
5´-ACGTATACTGTTGGTCTTAACG-3´
CS3-FF
تکثیر ژن cstH
5´-AAGCTTGACTATTTAATGATGCC-3´
CS3-RR
ساخت ژن هیبرید cstH::cbm و ساخت ژن هیبرید cstH::cbβm
5´- GTTGATGGATTAAGCTGTACAAATTGTGCGGCCAAATTTGAACGGAATGTAAAAGAAATTGAGGGTGTAACAGAAGCTATT-3´
80-F2
ساخت ژن هیبرید cstH::cbm
5´-GGGTGTAACAGAAGCTATTAATACTTTGGTGGGTGTTTTGAC-3´
38-F1
ساخت ژن هیبرید cstH::cbm و ساخت ژن هیبرید cstH::cbβm
5´-CAATTTGTACAGCTTAATCCATCAACAGAAACGCCAGTATTGGATAATG-3´
38-R
ساخت ژن هیبرید cstH::cbβm
5´-GGTGTAACAGAAGCTATTGTAAACTTTGGCGCATCAAAAATCACGGTAACAGGTGAAGCAAATACTTTGGTGGGTGTTTTGAC-3´
38b-F1
ساخت ژن هیبرید cstH::cbm
5´-GGGTGTAACAGAAGCTATTAAGAATGGTACAGTAACTTTTGC-3
66-F1
ساخت ژن هیبرید cstH::cbm و ساخت ژن هیبرید cstH::cbβm
5´-CAATTTGTACAGCTTAATCCATCAACAGATGTATCAGAAACATTTGTAC-3´
66-R
ساخت ژن هیبرید cstH::cbβm

5-5GTGTAACAGAAGCTATTGTAAACTTTGGCGCATCAAAAATCACGGTAACAGGTGAAG CAAAGAATGGTACAGTAACTTTTGC-3

66B-F1

ساخت ژن هیبرید cstH::cbm
5´-GGGTGTAACAGAAGCTATTTCTGCTAGCTTTGCCACCAC-3´
79-F1
ساخت ژن هیبرید cstH::cbm و ساخت ژن هیبرید cstH::cbβm
5´-CAATTTGTACAGCTTAATCCATCAACGTTATTTGTCTCATGTGCAAAAG-3´
79-R
ساخت ژن هیبرید cstH::cbBm
5´-GGGTGTAACAGAAGCTATTGTAAACTTTGGCGCATCAAAAATCACGGTAACAGGTGAAGCA TCTGCTAGCTTTGCCACCAC-3´
79B-F1
ساخت ژن هیبرید cstH::cbm
5´-GGGTGTAACAGAAGCTATTAACATTACGTTGGATAAAAATGC-3´
92-F1
ساخت ژن هیبرید cstH::cbm و ساخت ژن هیبرید cstH::cbβm
5´-CAATTTGTACAGCTTAATCCATCAACGGCATTATCTGTTGAAATGGTG-3´
92-RR
ساخت ژن هیبرید cstH::cbBm
5´-GGGTGTAACAGAAGCTATTGTAAACTTTGGCGCATCAAAAATCACGGTAACAGGTGAAGCAAACATTACGTTGGATAAAAATGC-3´
92B-F1
ساخت ژن هیبرید cstH::cbm
5´- GGGTGTAACAGAAGCTATTACAAATGGGAGTCAGTTGCC-3´
107-FF
ساخت ژن هیبرید cstH::cbm و ساخت ژن هیبرید cstH::cbβm
5´-CAATTTGTACAGCTTAATCCATCAACAGTTTTAACAATCGTATTTCCAG -3´
107-RR
ساخت ژن هیبرید cstH::cbβm
5´-GGGTGTAACAGAAGCTATTGTAAACTTTGGCGCATCAAAAATCACGGTAACAGGTGAAGC ACAAATGGGAGTCAGTTGCC-3´
107B-F1
ایجاد موتاسیون در موقعیت 64 ژن cstH
5´-CATTTGTAGTTTTCTCAATCGTATTTC-3´
CS3-F2 (Forward)
ایجاد موتاسیون در موقعیت 64 ژن cstH
5´-GAAATACGATTGAGAAAACTACAAATG-3´

CS3-F3 (Reverse)
-نوکلئوتیدهای کدکننده موتیف با حروف درشت و خط زیرین نشاندادهشدهاند. اعداد موجود نشاندهنده موقعیت ورود قطعه (جایگاه مجاز پروتئین) میباشد. اولیگونوکلئوتیدهای جهشزای رفت با حروف (F) و (bF)نشان داده شدهاند که با اولیگونوکلئوتید معکوس انتها (CS3-RR) بکار رفتهاند و اولیگونوکلئوتید جهش زای معکوس (R) با اولیگونوکلئوتیدهای رفت ابتدا (CS3-FF) بکاررفتهاند. یک جهش نقطهای در زیرواحد اصلی با دو اولیگونوکلئوتید مکمل CS3-F2 و CS3-R2که هریک به ترتیب با پرایمرهای CS3-RR و CS3-FFاستفاده شدند ایجاد گردید.

8-3-2 کیتهای آزمایشگاهی
در این تحقیق از کیتهای زیر استفاده شدهاست.
کیت استخراج پلاسمید (High Pure Plasmid Isolation Kit)، کیت استخراج DNA از ژل آگارز (Agarose Gel DNA Extraction Kit)، کیت خالص سازی محصول PCR ( High Pure PCR Product) (از شرکت Roche).

9-3-2 آنزیمها
آنزیمهایPfu DNA polymerase ، Taq DNA polymerase، RNase A و T4 DNA ligase و آنزیمهای برشی AocI،BamH1، HindIII و EcoRV از شرکت های Fermentase و Rocheتهیه و مطابق دستورالعمل شرکت سازنده و با بافر همراه آنزیم استفاده شدند.
پودر RNase A به غلظت mg/ml 10 در آب استريل حل و در دماي 20- درجه سانتیگراد نگهداري گرديد
10-3-2 نشانگرها
نشانگر وزن مولکولی 100 bp ladder و 1kb Ladder از شرکت Fermentas خریداری گردیدو نشانگر وزن ملکولی پروتئین (Low Molecular Weight Marker) از شرکت Merck تهیه شدند.

11-3-2 محلولها و بافرها
ترکیب محلولهاي مورد نياز براي استخراج DNA پلاسميدي در مقياس کم به روش ليز قليايي، محلولها و بافرهاي مورد نياز براي الکتروفرز DNA بر روي ژل آگارز و رنگ آميزي آن یعنی بافر TAE79، بافر بارگذاري80 DNA و محلول رنگ آميزي81 درپیوست یک به تفضیل آورده شدهاند
محلولها و بافرهاي لازم جهت کار با پروتئينها که در این تحقیق شامل بافر PBS، محلولها و بافرهاي مورد نياز جهت SDS-PAGE، محلولهاي لازم جهت رنگ آميزي و رنگ بري ژل SDS-PAGE، محلولها و بافرهاي لازم جهت وسترنبلاتينگ، محلولهای لازم برای سنجش پروتئین در پیوست دو ذکر شدهاست.

12-3-2 محیطهای کشت
از محيط کشت LB agar82 در تمامي مراحل کلونينگ به منظور کشت باکتريهاي مورد استفاده در اين تحقيق استفاده شد (پیوست سه).
1-12-3-2 محیطهایکشت CFA آگار
برای بیان پیلی CS3 از محیط کشت CFA83 آگار با ترکیبات،10 gr کازامینو اسید(از شرکت Difco)، 5/. گرم MgSo4.3H2O، 005/. گرمMnCl2. 4 H2O ، 5/1 گرم عصاره مخمر و 20 گرم آگار برای تهیه یک لیتر محیطکشت استفاده شد.

13-3-2 محلول‌هاي مورد نياز براي تهيه سلول‌هاي باكتريايي مستعد84
براي تهيه سلول‌هاي باكتريايي مستعد از محلول هاي 100 میلیمولارCaCl2 و50میلیمولارKCl استفاده شد. اين محلولها توسط اتوكلاو استریل شد. همچنين براي ذخيره

پایان نامه
Previous Entries پایان نامه ارشد درباره شبیه‌سازی، ساختار داده، انفورماتیک Next Entries پایان نامه ارشد درباره ماهیت کار