پایان نامه ارشد درباره 92.teoreical.construct، 92.experimental.construct، 107.teoretical.construct، 107.experimental.construct

دانلود پایان نامه ارشد

**************************** *********.**********

79m.experimental.construct CTAATACTTTGGTGGGTGTTTTGNCTCTTTCAAATACCAGTATTGATACA 450
79.teroretical.construct CTAATACTTTGGTGGGTGTTTTGACTCTTTCAAATACCAGTATTGATACA 291
*********************** **************************

79m.experimental.construct GTTAGCANTGCGAGTACAAATGTTTNTGATACATCTAAGAATGGTACAGT 500
79.teroretical.construct GTTAGCATTGCGAGTACAAATGTTTCTGATACATCTAAGAATGGTACAGT 341
*******.***************** ************************

79m.experimental.construct AACTTTTGCACATGAGACAAATANCGTTGATGGATTAAGCTGTACAAATT 550
79.teroretical.construct AACTTTTGCACATGAGACAAATAACGTTGATGGATTAAGCTGTACAAATT 391
*********************** **************************

79m.experimental.construct GTGCGGCCAAATTTGAACGGAATGTAAAAGAAATTGAGGGTGTNACAGAA 600
79.teroretical.construct GTGCGGCCAAATTTGAACGGAATGTAAAAGAAATTGAGGGTGTAACAGAA 441
******************************************* ******

79m.experimental.construct GCTATTTNNNNTNGCTTTGCCACCACCATTTCAACAGANNANNCCAACAT 650
79.teroretical.construct GCTATTTCTGCTAGCTTTGCCACCACCATTTCAACAGATAATGCCAACAT 491
******* .. * *************************. *..*******

79m.experimental.construct TACGTTGGATAAAAATGCNGGAAATANGATTGAGAAAACTACAAATGGGA 700
79.teroretical.construct TACGTTGGATAAAAATGCTGGAAATACGATTGTTAAAACTACAAATGGGA 541
******************.******* *****: ****************

79m.experimental.construct GTCAGTTGCCAACTAATTTACCACTTAAGTTTATTACCACTNAAGGTAAC 750
79.teroretical.construct GTCAGTTGCCAACTAATTTACCACTTAAGTTTATTACCACTGAAGGTAAC 591
*****************************************.********

79m.experimental.construct GAACATTTAGTTTCAGGTAATTNCCGTGCAAATATNACAATTACTTCGAC 800
79.teroretical.construct GAACATTTAGTTTCAGGTAATTACCGTGCAAATATAACAATTACTTCGAC 641
********************** ************ **************

79m.experimental.construct AATTAAATAATTATATAATAGACGTAGCCTTCGAAATAAAGGCTACGTTG 850
79.teroretical.construct AATTAAATAATTATATAATAGACGTAGCCTTCGAAATAAAGGCTACGTTG 691
**************************************************

79m.experimental.construct CNATCTTTATGTTTGTGATTTANNNNNATCATTAAATAGTCAAGCTTATC 900
79.teroretical.construct CTATCTTTATGTTTGTGATTTATAGGCATCATTAAATAGTCAAGCTT— 738
*.********************. .. ********************

79m.experimental.construct CCGCAAGAGGCCCGGCAGTACCGGCATAACCAANCCTATGCNTNNNNNNN 950
79.teroretical.construct ————————————————–

*********************************************************************

CLUSTAL 2.1 multiple sequence alignment

92.teoreical.construct TATGAGGGATTCGATGTTAAAAATAAAATACTTATTAATAGGTCTTTCAC 100
92.experimental.construct ——————NNNNNTAAANNNNNNNTTAATAGNTNTTTCAC 32
**** . .. *******.* ******

92.teoreical.construct TG-TCAGCTATGAGTTCATACTCACTAGCTGCAGCGGGGCCCACTCTAAC 149
92.experimental.construct TGTTCAGNTATGAGTTCATACTCNCNNNNTGCAGCGGGGCCCACTNTAAC 82
** **** *************** *. . **************** ****

92.teoreical.construct CAAA-GAACTGGCATTAAATGTGCTTTCTCCTGCAGCTCTGGATGCAACT 198
92.experimental.construct CAAANGNANNGGCATTNAATGTGNTTTNTCNNGCAGCTCTGGATGCAACT 132
**** * * .****** ****** *** ** .******************

92.teoreical.construct TGGGCTCCTCAGGATAATTTAACATTATCCAATACTGGCGTTTCTAATAC 248
92.experimental.construct TGGGCTCCTCAGGATAATTTAACATTATCCAATACTGGCGTTTNTAATAC 182
******************************************* ******

92.teoreical.construct TTTGGTGGGTGTTTTGACTCTTTCAAATACCAGTATTGATACAGTTAGCA 298
92.experimental.construct TTTGGTGGGTGTTTTGACTCTTTCAAATACCAGTATTGATACAGTTAGCA 232
**************************************************

92.teoreical.construct TTGCGAGTACAAATGTTTCTGATACATCTAAGAATGGTACAGTAACTTTT 348
92.experimental.construct TTGNGAGTACAAA-GTTTNNGATACATCTAAGAATGGTACANTAACTTN- 280
*** ********* **** .*********************.******.

92.teoreical.construct GCACATGAGACAAATAACTCTGCTAGCTTTGCCACCACCATTTCAACAGA 398
92.experimental.construct GCACATGAGACAAANAACTNTGCTAGNTTTGCCACCACCATTTCAACAGA 330
**************.**** ****** ***********************

92.teoreical.construct TAATGCCGTTGATGGATTAAGCTGTACAAATTGTGCGGCCAAATTTGAAC 448
92.experimental.construct TAATNCCGNTGATGGATTAAGCNGTACAAATTGTGCGGCCAAATTTGAAC 380
****.***.*************.***************************

92.teoreical.construct GGAATGTAAAAGAAATTGAGGGTGTAACAGAAGCTATTAACATTACGTTG 498
92.experimental.construct GGAATGTAAAAGAAATTGAGGGTGTAACANAAGCTATTAACATTACGTTG 430
*****************************.********************

92.teoreical.construct GATAAAAATGCTGGAAATACGATTGTTAAAACTACAAATGGGAGTCAGTT 548
92.experimental.construct GATAAAAATGCTGGAAATACGATTGTTAAAACTACAAATGGGAGTCAGTT 480
**************************************************

92.teoreical.construct GCCAACTAATTTACCACTTAAGTTTATTACCACTGAAGGTAACGAACATT 598
92.experimental.construct GCCAACTAATTNNCCANTTAAGTTTATTACCANTGAAGGTAANGNACATT 530
***********. *** *************** ********* * *****

92.teoreical.construct TAGTTTCAGGTAATTACCGTGCAAATATAACAATTACTTCGACAATTAAA 648
92.experimental.construct TAGTTTCAGGTAATTACCGTGCAAATATAACAATTACTTNGNCAATTAAA 580
*************************************** * ********

92.teoreical.construct TAATTATATAATAGACGTAGCCTTCGAAATAAAGGCTACGTTGCTATCTT 698
92.experimental.construct TAATTATATAATAGANGTAGCCTTCGAAATAAAGGCTACGTTGCTATNTT 630
*************** ******************************* **

92.teoreical.construct TATGTTTGTGATTTATAGGCATCATTAAATAGTCAAGCTT———- 738
92.experimental.construct NATGTTNGTGATTNNNNNNNATCATTAAATAGTCAAGCTTNTCCCNCAAN 680
.*****.******. . .. ********************
******************************************************************

CLUSTAL 2.1 multiple sequence alignment

107.teoretical.construct TATGAGGGATTCGATGTTAAAAATAAAATACTTATT-AATAGGTCTTT-C 98
107.experimental.construct ——————-AAAAANAAATACTTATTAAATAGGTCTTTTC 40
****: *********** *********** *

107.teoretical.construct ACTGTCAGCTATGAGTTCATACTCACTAGCTGCAGCGGGGCCCACTCTAA 148
107.experimental.construct ACNGTCANNTATGANTTCATACTCACTAGCTGCAGCGGNGCCCNCTCT-A 89
**.****. *****.***********************.**** **** *

107.teoretical.construct CCAAAGAACTGGCATTAAATGTGCTTTCTCCTGCAGCTCTGGATGCAACT 198
107.experimental.construct CCAAAGAANTGGCATTAAATGTGCTTTCTCNTGCAGCTCTGGATGCAACT 139
******** ********************* *******************

107.teoretical.construct TGGGCTCCTCAGGATAATTTAACATTATCCAATACTGGCGTTTCTAATAC 248
107.experimental.construct TGGGCTCCTCAGGATAATTNAACATTATCCAATANTGGCGTTTNTAATAC 189
*******************.************** ******** ******

107.teoretical.construct TTTGGTGGG-TGTTTTGACTCTTTCAAATACCAGTATTGATACAGTTAGC 297
107.experimental.construct TNTGGTGGGGTGTTTNGANTCTTTCAAATACCAGTATTGATANAGTTAGC 239
*.******* *****.** *********************** *******

107.teoretical.construct ATTGCGAGTACAAATGTTTCTGATACATCTAAGAATGGTACAGTAACTTT 347
107.experimental.construct ATTGNGAGTACAAATGTTTNTGATACATCTAAGAATGGTACAGTAACTTT 289
**** ************** ******************************

107.teoretical.construct TGCACATGAGACAAATAACTCTGCTAGCTTTGCCACCACCATTTCAACAG 397
107.experimental.construct TGCACATGAGACAAATAACTNTGNTAGCTTTGCCACCACCNTTTCAACAG 339
******************** ** **************** *********

107.teoretical.construct ATAATGCCAACATTACGTTGGATAAAAATGCTGGAAATACGATTGTTAAA 447
107.experimental.construct ATAATGCCAACATTACGTTGGATAAAAATGCTGGAAATANGATTGTTAAA 389
*************************************** **********

107.teoretical.construct ACTGTTGATGGATTAAGCTGTACAAATTGTGCGGCCAAATTTGAACGGAA 497
107.experimental.construct ANNGTNGATGGATTAAGCTGTACAAATTGTGNGGNCAAATTTGAACGGAA 439
* .**.************************* ** ***************

107.teoretical.construct TGTAAAAGAAATTGAGGGTGTAACAGAAGCTATTACAAATGGGAGTCAGT 547
107.experimental.construct TGTAAAAGAAATTGAGGGNGTAACAGAAGCTATTACAAATGGGAGTCAGN 489
******************.******************************.

107.teoretical.construct TGCCAACTAATTTACCACTTAAGTTTATTACCACTGAAGGTAACGAACAT 597
107.experimental.construct TGCCAANTAATTTACCACTTAAGTTTATTACCACTGAAGGTAANGAACAT 539
****** ************************************ ******

107.teoretical.construct TTAGTTTCAGGTAATTACCGTGCAAATATAACAATTACTTCGACAATTAA 647
107.experimental.construct TTAGTTTCAGGTAATTACCGTGCAAATATAACAATTACTTCGACAATTAA 589
**************************************************

107.teoretical.construct

پایان نامه
Previous Entries پایان نامه ارشد درباره **************************************************، 79.experimental.construct، 79.teoretical.construct، 67.teoretical.construct Next Entries پایان نامه ارشد درباره 39BF.experimental.constract، 38-39MB.theoretical.costruct، 66-67Mbeta.teoretical.construc، 67BF.experimental.construct