پایان نامه ارشد درباره 39BF.experimental.constract، 38-39MB.theoretical.costruct، 66-67Mbeta.teoretical.construc، 67BF.experimental.construct

دانلود پایان نامه ارشد

ATAATTATATAATAGACGTAGCCTTCGAAATAAAGGCTACGTTGCTATCT 697
107.experimental.construct ATAATTATATAATAGACGTAGCCTTNGAAATAAAGGCTACGTTGCTATCT 639
************************* ************************

107.teoretical.construct TTATGTTTGTGATTTATAGGCATCATTAAATAGTCAAGCTT——— 738
107.experimental.construct TTATGTTTGTGATTTATNGNNATCATTAAATAGTCAAGCTTATNCCGCAA 689
***************** *. ********************

شکل الف: سازههای آزمایشگاهی که حاصل کلونینگ طول کامل ژن هیبرید cstH::cbm در ناقلpBR322 میباشند و صحت کلونینگ آنها در مرحله قبل بوسیله مقاومت آنتیبیوتیکی، برش آنزیمی و واکنش PCR تائید شدهبود. در این مرحله با استفاده از پرایمر رفت و پرایمر برگشت دو سوی ژن tet تعیین توالی شده و سپس با استفاده از نرم افزار ClustalW با سازه تئوری همتای خود همردیف گردیدند. از آنجائیکه که محل اتصال پرایمر مورد استفاده در دو طرف محل کلونینگ (جایگاه آنزیمی E.coR V) در ناقل میباشد، لذا در تمام موارد دو سوی ژن هیبرید نیز تعینن توالی شده از اینرو ابتدا و انتهای همردیفی دارای شکاف میباشد که تا حد امکان آنها را حذف کردهایم. دقت شود سازهها بر اساس محل ورود پپتید متصل شونده به فلز سنگین نامگذاری شدهاند.

CLUSTAL 2.1 multiple sequence alignment

39BF.experimental.constract NGANTNTACNGTNG-TNTTAACGTAACCCNGTAANNNTNATTTAAAGNGA 249
38-39MB.theoretical.costruct -ACGTATACTGTTGGTCTTAACGTAACCA-GTAATG-TTATTTAAAGTGA 47
…* ***.**.* * ***********. ****.. *.********.**

39BF.experimental.constract ANGNNNNAGGGNTNNGNTG-TAAAAATAAAATNCTN-TTAATAGNTNTTT 297
38-39MB.theoretical.costruct ATGTATGAGGGATTCGATGTTAAAAATAAAATACTTATTAATAGGTCTTT 97
*.*. ..**** *. * ** ************ **. *******.* ***

39BF.experimental.constract CANTGTNAGNTATGAGTTNATACTCACTAGNNGCAGCGGGGCCCACTNTA 347
38-39MB.theoretical.costruct CACTGTCAGCTATGAGTTCATACTCACTAGCTGCAGCGGGGCCCACTCTA 147
** *** ** ******** *********** .*************** **

39BF.experimental.constract ACCAAAGAACTGGCATTAAATNTGCTTTNNNN-GCAGNTNNGGATGCAAN 396
38-39MB.theoretical.costruct ACCAAAGAACTGGCATTAAATGTGCTTTCTCCTGCAGCTCTGGATGCAAC 197
*********************.****** . **** * .********

39BF.experimental.constract TTGGGNTCNTCAGGATAATTTAACATTATCCAATACTGGCGTTTNTGTTG 446
38-39MB.theoretical.costruct TTGGGCTCCTCAGGATAATTTAACATTATCCAATACTGGCGTTTCTGTTG 247
***** ** *********************************** *****

39BF.experimental.constract ATGGATTANGCTGTACAAATNGTGCGGCCAAATTTGAACGGAATGTAAAA 496
38-39MB.theoretical.costruct ATGGATTAAGCTGTACAAATTGTGCGGCCAAATTTGAACGGAATGTAAAA 297
******** ***********.*****************************

39BF.experimental.constract GAAATNGAGGGTGTAACAGAAGNTATNGTAAACTTTGGCGNATCAAAAAT 546
38-39MB.theoretical.costruct GAAATTGAGGGTGTAACAGAAGCTATTGTAAACTTTGGCGCATCAAAAAT 347
*****.**************** ***.************* *********

39BF.experimental.constract CACGGTAACAGGTGAAGCAAATACTTTGGTGGGTGTTTTGACTCTTTCAA 596
38-39MB.theoretical.costruct CACGGTAACAGGTGAAGCAAATACTTTGGTGGGTGTTTTGACTCTTTCAA 397
**************************************************

39BF.experimental.constract ATACCAGTATTGATACAGTTAGCATTGCGAGTACAAATGTTTNTGATACA 646
38-39MB.theoretical.costruct ATACCAGTATTGATACAGTTAGCATTGCGAGTACAAATGTTTCTGATACA 447
****************************************** *******

39BF.experimental.constract TNTAAGAATGGTACAGTAACTTTTGCACATGAGACAAATAACTNTGCTAG 696
38-39MB.theoretical.costruct TCTAAGAATGGTACAGTAACTTTTGCACATGAGACAAATAACTCTGCTAG 497
* ***************************************** ******

39BF.experimental.constract CTTTGCCACCACCATTTCAACAGATAATGCCAACATTACGTTGGATAAAA 746
38-39MB.theoretical.costruct CTTTGCCACCACCATTTCAACAGATAATGCCAACATTACGTTGGATAAAA 547
**************************************************

39BF.experimental.constract ATGCTGGAAATACGATTGTTAAAACTACAAATGGGAGTCAGTTGCCAACT 796
38-39MB.theoretical.costruct ATGCTGGAAATACGATTGTTAAAACTACAAATGGGAGTCAGTTGCCAACT 597
**************************************************

39BF.experimental.constract AATTTACCACTTAAGTTTATTACCACTGAAGGTAACGAACATTTAGTTTC 846
38-39MB.theoretical.costruct AATTTACCACTTAAGTTTATTACCACTGAAGGTAACGAACATTTAGTTTC 647
**************************************************

39BF.experimental.constract AGGTAATTACCGTGCAAATATAACAATTACTTCGACAATTAAATAATTAT 896
38-39MB.theoretical.costruct AGGTAATTACCGTGCAAATATAACAATTACTTCGACAATTAAATAATTAT 697
**************************************************

39BF.experimental.constract ATAATAGACGTANCCTTCGAAATAAAGGCTACGTTGCTATCTTTATGTTT 946
38-39MB.theoretical.costruct ATAATAGACGTAGCCTTCGAAATAAAGGCTACGTTGCTATCTTTATGTTT 747
************.*************************************

39BF.experimental.constract GTGATTTATAGGCATCATTAAATAGTCAAGCTTATCCCGCAAGAGGCCCG 996
38-39MB.theoretical.costruct GTGATTTATAGGCATCATTAAATAGTCAAGCTT—————– 780
*********************************

39BF.experimental.constract GCAGTACCGGCATAACCAAGCCTATGCCTACAGCATCCAGGGTGACGGTG 1046
38-39MB.theoretical.costruct ————————————————–

*******************************************************************
CLUSTAL 2.1 multiple sequence alignment

67BF.experimental.construct GCCATAGTGACTGGCGATGCTGTNGGAATGGACGATACGTATACTGTTGG 250
66-67Mbeta.teoretical.construc ————————————ACGTATACTGTTGG 14
**************

67BF.experimental.construct TNTTAACGTAACCCAGTAATGTTATTTAAAGTGAATGTATGAGGGATTCG 300
66-67Mbeta.teoretical.construc TCTTAACGTAACCAG-TAATGTTATTTAAAGTGAATGTATGAGGGATTCG 63
* ***********.. **********************************

67BF.experimental.construct ATGTTAAAAATAAAATACTTATTAATAGNTCTTTCACTNTCAGCTATGAG 350
66-67Mbeta.teoretical.construc ATGTTAAAAATAAAATACTTATTAATAGGTCTTTCACTGTCAGCTATGAG 113
****************************.*********.***********

67BF.experimental.construct TTCATACTCACTAGCTGCAGCGGGGCCCACTCTAACCAAAGAACTGGCAT 400
66-67Mbeta.teoretical.construc TTCATACTCACTAGCTGCAGCGGGGCCCACTCTAACCAAAGAACTGGCAT 163
**************************************************

67BF.experimental.construct TAAATGTGCTTTCTCCTGCAGCTCTGGATGCAACTTGGGCTCCTCAGGAT 450
66-67Mbeta.teoretical.construc TAAATGTGCTTTCTCCTGCAGCTCTGGATGCAACTTGGGCTCCTCAGGAT 213
**************************************************

67BF.experimental.construct AATTTANCATTATCCAATACTGGCGTTTCTAATACTTTGGTGGGTGTTTT 500
66-67Mbeta.teoretical.construc AATTTAACATTATCCAATACTGGCGTTTCTAATACTTTGGTGGGTGTTTT 263
****** *******************************************

67BF.experimental.construct GACTCTTTCAAATACCAGTATTGATACAGTTAGCATTGCGAGTACAAATG 550
66-67Mbeta.teoretical.construc GACTCTTTCAAATACCAGTATTGATACAGTTAGCATTGCGAGTACAAATG 313
**************************************************

67BF.experimental.construct TTTCTGATACATCTAAGAATGGTACAGTAACTTTTGCACATGAGACAAAT 600
66-67Mbeta.teoretical.construc TTTCTGATACATCTGTTGATGG—ATTAAGCTGTACAAATTGTGCGGCC 360
**************.: .**** * *** * *.**.** . .*…

67BF.experimental.construct AACTCTGCTAGCTTTGCCACCACCATT———TCAACAGATAATGC 641
66-67Mbeta.teoretical.construc AAATTTGAACGGAATGTAAAAGAAATTGAGGGTGTAACAGAAGCTATTGT 410
**.* **.:.* ::** .*…..*** :**..**.**:**

67BF.experimental.construct CAACATTACGTTGGATAAAAATGCTGGAAATACGATTGTTANAACTGTTG 691
66-67Mbeta.teoretical.construc AAACTTTGG–CGCATCAAAAATCACGGTAACAGG-TGAAGCAAAGAATG 457
.***:**. * **.****: *: *.:*:..*. **::. **. .:**

67BF.experimental.construct ATGGATTAAGCTGTACAAATTGTGCGGCCAAATTTGAACGGAATGTAAAA 741
66-67Mbeta.teoretical.construc GTACAGTAACTTTTGCACATGAGACAAATAACTCTGCTAGCTTTGCCACC 507
.*. * *** * *.**.** . .*… **.* **.:.* ::** .*..

67BF.experimental.construct GAAATTGAGGGTGTAACAGAAGCTATTGTAAACTTTGGCGCATCAAAAAT 791
66-67Mbeta.teoretical.construc ACCATTTCAACAGATAATGCCAACATTACGTTGGATAAAAATGCTGGAAA 557
…*** … :*::*.:*…. ***. .:: :*…..: *:..**:

67BF.experimental.construct CACGGTAACAGGTGAAGCACAAATGGGAGTCAGTTGCCAACTAATTTACC 841
66-67Mbeta.teoretical.construc TACGATTGTT–AAAACTACAAATGGGAGTCAGTTGCCAACTAATTTACC 605
***.*:. : :.** ********************************

67BF.experimental.construct ACTTAAGTTTATTACCACTGAAGGTAACGAACATTTAGTTTCAGGTAATT 891
66-67Mbeta.teoretical.construc ACTTAAGTTTATTACCACTGAAGGTAACGAACATTTAGTTTCAGGTAATT 655

پایان نامه
Previous Entries پایان نامه ارشد درباره 92.teoreical.construct، 92.experimental.construct، 107.teoretical.construct، 107.experimental.construct Next Entries پایان نامه با کلید واژه های پوشش گیاهی، استان گیلان، استان فارس، نفوذپذیری