پایان نامه ارشد درباره  ،    N،    -، T 

دانلود پایان نامه ارشد

0.009   0.160   0.520   0.227       N
T      46    0.254   0.160   0.478   0.247       N
L      47    0.020   0.000   0.479   0.132       N
S      48    0.035   0.160   0.428   0.149       N
N      49    0.019   0.160   0.452   0.111       N
T      50    0.759   0.000   0.444   0.149       N
S      51    0.844   0.000   0.448   0.324       N
I      52    0.097   0.000   0.412   0.075       N
D      53    0.010   0.160   0.430   0.203       N
T      54    0.915   0.160   0.451   0.179       N
V      55    0.853   0.160   0.476   0.324       N
S      56    0.000   0.330   0.469   0.000       –
I      57    0.140   0.330   0.495   0.226       N
A      58    0.014   0.160   0.498   0.116       N
S      59    0.000   0.000   0.476   0.000       –
T      60    0.790   0.000   0.457   0.125       N
N      61    0.000   0.000   0.537   0.000       –
V      62    0.111   0.000   0.446   0.090       N
S      63    0.000   0.000   0.452   0.000       –
D      64    0.087   0.000   0.433   0.137       N
T      65    0.025   0.000   0.464   0.030       N
S      66    0.093   0.000   0.434   0.064       N
K      67    0.005   0.000   0.490   0.063       N
N      68    0.005   0.000   0.480   0.104       N
G      69    0.000   0.000   0.485   0.000       –
T      70    0.000   0.000   0.495   0.000       –
V      71    0.000   0.000   0.566   0.000       –
T      72    0.235   0.000   0.544   0.054       N
F      73    0.000   0.000   0.660   0.000       –
A      74    0.020   0.000   0.600   0.083       N
H      75    0.000   0.000   0.515   0.000       –
E      76    0.854   0.000   0.540   0.189       N
T      77    0.957   0.000   0.450   0.188       N
N      78    0.338   0.000   0.456   0.122       N
N      79    0.973   0.000   0.486   0.141       N
S      80    0.965   0.000   0.552   0.187       N
A      81    0.106   0.000   0.587   0.210       N
S      82    0.117   0.000   0.601   0.015       N
F      83    0.430   0.000   0.671   0.085       N
A      84    0.000   0.000   0.550   0.000       –
T      85    0.000   0.000   0.610   0.000       –
T      86    0.027   0.490   0.536   0.448       P
I      87    0.000   0.490   0.552   0.000       –
S      88    0.000   0.160   0.517   0.000       –
T      89    0.695   0.490   0.541   0.445       P
D      90    0.855   0.660   0.551   0.477       P
N      91    0.067   0.490   0.538   0.421       P
A      92    0.818   0.660   0.504   0.504       P
N      93    0.027   0.660   0.491   0.507       P
I      94    0.881   0.830   0.468   0.534       P
T      95    0.000   0.660   0.460   0.000       –
L      96    0.000   0.990   0.536   0.000       –
D      97    0.000   0.490   0.464   0.000       –
K      98    0.009   0.160   0.494   0.141       N
N      99    0.000   0.000   0.474   0.000       –
A     100    0.027   0.000   0.463   0.092       N
G     101    0.005   0.000   0.483   0.051       N
N     102    0.076   0.160   0.479   0.208       N
T     103    0.702   0.330   0.455   0.380       P
I     104    0.851   0.330   0.470   0.352       P
V     105    0.875   0.660   0.449   0.541       P
K     106    0.015   0.830   0.453   0.485       P
T     107    0.017   0.330   0.454   0.311       N
T     108    0.685   0.330   0.479   0.365       P
N     109    0.012   0.330   0.468   0.250       N
G     110    0.000   0.160   0.445   0.000       –
S     111    0.034   0.160   0.428   0.256       N
Q     112    0.000   0.330   0.441   0.000       –
L     113    0.000   0.000   0.414   0.000       –
P     114    0.109   0.000   0.388   0.140       N
T     115    0.051   0.160   0.429   0.158       N
N     116    0.073   0.160   0.430   0.181       N
L     117    0.535   0.160   0.441   0.185       N
P     118    0.000   0.490   0.451   0.000       –
L     119    0.025   0.660   0.516   0.376       P
K     120    0.000   0.490   0.502   0.000       –
F     121    0.114   0.830   0.568   0.447       P
I     122    0.000   0.000   0.598   0.000       –
T     123    0.049   0.490   0.566   0.363       P
T     124    0.036   0.330   0.569   0.246       N
E     125    0.036   0.160   0.541   0.146       N
G     126    0.006   0.000   0.586   0.157       N
N     127    0.009   0.000   0.610   0.015       N
E     128    0.005   0.000   0.573   0.112       N
H     129    0.958   0.000   0.548   0.192       N
L     130    0.972   0.000   0.597   0.166       N
V     131    0.861   0.000   0.561   0.212       N
S     132    0.032   0.000   0.576   0.149       N
G     133    0.154   0.000   0.614   0.211       N
N     134    0.170   0.000   0.584   0.155       N
Y     135    0.025   0.000   0.656   0.181       N
R     136    0.833   0.000   0.606   0.175       N
A     137    0.079   0.000   0.579   0.075       N
N     138    0.022   0.000   0.500   0.089       N
I     139    0.890   0.000   0.529   0.182       N
T     140    0.916   0.000   0.424   0.122       N
I     141    0.872   0.160   0.465   0.197       N
T     142    0.101   0.000   0.423   0.084       N

پیشگویی با روش meta-PPISP
Column 1: AA (Amino Acid code)
Column 2: Ch (Chain ID)
Column 3: AA# (Amino Acid number)
Column 4-7: Prediction scores of cons-PPISP, PINUP, Promate, and meta-PPISP Note: PINUP and Promate scores are scaled by 100
Column 8: Prediction of whether the residue is in an interface (P = Positive; N = Negative; – = Burried and not predicted)
(Note: P corresponds to a score 0.34 in 7th column; user may set a
different threshold for positive prediction.)

پیشگویی با روشcons-PPISP
Column 1: AA (Amino Acid code)
Column 2: Ch (Chain ID)
Column 3: AA# (Amino Acid number)
Column 4: Score (neural network score)
Column 5: Prediction of whether the residue contacts (P = Positive; N = Negative; – = Burried and not predicted)

پیوست 8- توالیهای بدست آمده با استفاد از تکنیک تعیین توالی و نتیجه بررسی همسانی آنها با ژنهای اصلی که در ادامه آورده شده است.
CLUSTAL 2.1 multiple sequence alignment

38.experimental.construct CACGCCNTNGNGACNGNCGANGCNNTCGGNAATGGNCGATACGTATACTG 100
38.teoretical.construct —————————————-ACGTATACTG 10
**********

38.experimental.construct TTGNTCTTAACGTNACCAGTAATGTTATTN-AAGTGAATGTATGAGGGGA 149
38.teoretical.construct TTGGTCTTAACGTAACCAGTAATGTTATTTAAAGTGAATGTATGAGGG-A 59
***.********* ***************. ***************** *

38.experimental.construct TTCGATGTTAAAAATAAAATACT-ATTAATAGGTCTTTCACTGTCAGNTA 198
38.teoretical.construct TTCGATGTTAAAAATAAAATACTTATTAATAGGTCTTTCACTGTCAGCTA 109
*********************** *********************** **

38.experimental.construct TGAGTTCATACTCACTANNTGCAGCGGGGNCCACTCTAACCAAAGAACTG 248
38.teoretical.construct TGAGTTCATACTCACTAGCTGCAGCGGGGCCCACTCTAACCAAAGAACTG 159
*****************. ********** ********************

38.experimental.construct GCATTAAATGTGCTTTCTCNTGCAGCTCNGGATGCAACTTGGGCTCCTCA 298
38.teoretical.construct GCATTAAATGTGCTTTCTCCTGCAGCTCTGGATGCAACTTGGGCTCCTCA 209
******************* ********.*********************

38.experimental.construct GGATAATTTAACATTATCCAATACTGGCGTTTCTGTTGATGGATTAAGCT 348
38.teoretical.construct GGATAATTTAACATTATCCAATACTGGCGTTTCTGTTGATGGATTAAGCT 259
**************************************************

38.experimental.construct GTACAAATTGTGNGGCCAAATTTGAACGGAATGTAAAAGAAATTGAGGGT 398
38.teoretical.construct GTACAAATTGTGCGGCCAAATTTGAACGGAATGTAAAAGAAATTGAGGGT 309
************ *************************************

38.experimental.construct GTAACAGAAGCTATTAATACTTTGGTGGGTGTTTTGACTCTTTCAAATAC 448
38.teoretical.construct GTAACAGAAGCTATTAATACTTTGGTGGGTGTTTTGACTCTTTCAAATAC 359
**************************************************

38.experimental.construct CAGTATTGATACAGTTAGCATTGCGAGTACAAATGTTTCTGATACATCTA 498
38.teoretical.construct CAGTATTGATACAGTTAGCATTGCGAGTACAAATGTTTCTGATACATCTA 409
**************************************************

38.experimental.construct AGAATGGTACAGTAACTTTTGCACATGAGACAAATAACTNTNCTAGCTTT 548
38.teoretical.construct AGAATGGTACAGTAACTTTTGCACATGAGACAAATAACTCTGCTAGCTTT 459
*************************************** *.********

38.experimental.construct GCCACCACCATTTCAACAGANAANGCCAACATTACGTTGGATAAAAATGC 598
38.teoretical.construct GCCACCACCATTTCAACAGATAATGCCAACATTACGTTGGATAAAAATGC 509
********************.**.**************************

38.experimental.construct TGGAAATACGATTGTTAAAACTACAAATGGGAGTCAGTTGCCAACTAATT 648
38.teoretical.construct TGGAAATACGATTGTTAAAACTACAAATGGGAGTCAGTTGCCAACTAATT 559
**************************************************

38.experimental.construct TACCACTTAAGTTTATTACCACTGAAGGTAACGAACATTTAGTTTCAGGT 698
38.teoretical.construct TACCACTTAAGTTTATTACCACTGAAGGTAACGAACATTTAGTTTCAGGT 609
**************************************************

38.experimental.construct AATTNCCGTGCAAATATAACAATTACTTNGACAATTAAATAATTATATAA 748
38.teoretical.construct AATTACCGTGCAAATATAACAATTACTTCGACAATTAAATAATTATATAA 659
**** *********************** *********************

38.experimental.construct TAGACGTAGCCTTCGAAATAAAGGNTACGTTGCTATCTTTATGTTTGTGA 798
38.teoretical.construct TAGACGTAGCCTTCGAAATAAAGGCTACGTTGCTATCTTTATGTTTGTGA 709
************************ *************************

38.experimental.construct

پایان نامه
Previous Entries پایان نامه ارشد درباره  ،    N، T ، N  Next Entries پایان نامه ارشد درباره **************************************************، 79.experimental.construct، 79.teoretical.construct، 67.teoretical.construct