پایان نامه ارشد درباره **************************************************، 80bfm.teoritical.construct، 80BFm.experimental.construct، 92BF.experimental.construct

دانلود پایان نامه ارشد

**************************************************

67BF.experimental.construct MCCGTGCAAATATAACAATTACTTCGACAATTAAATAATTATATAATAGA 941
66-67Mbeta.teoretical.construc ACCGTGCAAATATAACAATTACTTCGACAATTAAATAATTATATAATAGA 705
*************************************************

67BF.experimental.construct CGTANCCTTCGAAATAAAGGCTACGTTGCTATCTTTATGTTTGTGATTTA 991
66-67Mbeta.teoretical.construc CGTAGCCTTCGAAATAAAGGCTACGTTGCTATCTTTATGTTTGTGATTTA 755
****.*********************************************

*********************************************************************

CLUSTAL 2.1 multiple sequence alignment

80BFm.experimental.construct GGCGATGCTGTNGNAATGGACGATACGTATACTNTNGNTNTTAACGTANC 250
80bfm.teoritical.construct ————————ACGTATACTGTTGGTCTTAACGTA-A 25
*********.*.*.* ******** .

80BFm.experimental.construct CCAGTAATGTTATTTAAAGTGAATGTATGAGGGATTCGATGTTAAAAATA 300
80bfm.teoritical.construct CCAGTAATGTTATTTAAAGTGAATGTATGAGGGATTCGATGTTAAAAATA 75
**************************************************

80BFm.experimental.construct AAATACTTATTAATAGGTCTTTCACTNTCAGCTATGAGTTCATACTCACT 350
80bfm.teoritical.construct AAATACTTATTAATAGGTCTTTCACTGTCAGCTATGAGTTCATACTCACT 125
**************************.***********************

80BFm.experimental.construct AGCTGCAGCGGGGCCCACTCTAACCAAAGAACTGGCATTAAATGTGCTTT 400
80bfm.teoritical.construct AGCTGCAGCGGGGCCCACTCTAACCAAAGAACTGGCATTAAATGTGCTTT 175
**************************************************

80BFm.experimental.construct CTCNTGCAGCTCTGGATGCAACTTGGGCTCNTCAGGATAATTTAACATTA 450
80bfm.teoritical.construct CTCCTGCAGCTCTGGATGCAACTTGGGCTCCTCAGGATAATTTAACATTA 225
*** ************************** *******************

80BFm.experimental.construct TCCAATACTGGCGTTTCTAATACTTTGGTGGGTGTTTTGACTCTTTCAAA 500
80bfm.teoritical.construct TCCAATACTGGCGTTTCTAATACTTTGGTGGGTGTTTTGACTCTTTCAAA 275
**************************************************

80BFm.experimental.construct TACCAGTATTGATACAGTTAGCATTGCGAGTACAAATGTTTCTGATACAT 550
80bfm.teoritical.construct TACCAGTATTGATACAGTTAGCATTGCGAGTACAAATGTTTCTGATACAT 325
**************************************************

80BFm.experimental.construct CTAAGAATGGTACAGTAACTTTTGCACATGAGACAAATAACGTTGATGGA 600
80bfm.teoritical.construct CTAAGAATGGTACAGTAACTTTTGCACATGAGACAAATAACGTTGATGGA 375
**************************************************

80BFm.experimental.construct TTAAGCTGTACAAATTGTGCGGCCAAATTTGAACGGAATGTAAAAGAAAT 650
80bfm.teoritical.construct TTAAGCTGTACAAATTGTGCGGCCAAATTTGAACGGAATGTAAAAGAAAT 425
**************************************************

80BFm.experimental.construct TGAGGGTGTAACAGAAGCTATTGTAAACTTTGGCGCATCAAAAATCACGG 700
80bfm.teoritical.construct TGAGGGTGTAACAGAAGCTATTGTAAACTTTGGCGCATCAAAAATCACGG 475
**************************************************

80BFm.experimental.construct TAACAGGTGAAGCATCTGCTAGCTTTGCCACCACCATTTCAACAGATAAT 750
80bfm.teoritical.construct TAACAGGTGAAGCATCTGCTAGCTTTGCCACCACCATTTCAACAGATAAT 525
**************************************************

80BFm.experimental.construct GCCAACATTACGTTGGATAAAAATGCTGGAAATACGATTGAGAAAACTAC 800
80bfm.teoritical.construct GCCAACATTACGTTGGATAAAAATGCTGGAAATACGATTGTTAAAACTAC 575
****************************************: ********

80BFm.experimental.construct AAATGGGAGTCAGTTGCCAACTAATTTACCACTTAAGTTTATTACCACTG 850
80bfm.teoritical.construct AAATGGGAGTCAGTTGCCAACTAATTTACCACTTAAGTTTATTACCACTG 625
**************************************************

80BFm.experimental.construct AAGGTAACGAACATTTAGTTTCAGGTAATTACCGTGCAAATATAACAATT 900
80bfm.teoritical.construct AAGGTAACGAACATTTAGTTTCAGGTAATTACCGTGCAAATATAACAATT 675
**************************************************

80BFm.experimental.construct ACTTCGACAATTAAATAATTATATAATAGACGTANCCTTCGAAATAAAGG 950
80bfm.teoritical.construct ACTTCGACAATTAAATAATTATATAATAGACGTAGCCTTCGAAATAAAGG 725
**********************************.***************

80BFm.experimental.construct CTACGTTGCTATCTTTATGTTTGTGATTTATAGGCATCATTAAATAGTCA 1000
80bfm.teoritical.construct CTACGTTGCTATCTTTATGTTTGTGATTTATAGGCATCATTAAATAGTCA 775
**************************************************

80BFm.experimental.construct AGCTTATCCCGCAAGAGGCCCGGCAGTACCGGCATAACCAAGCCTATGCC 1050
80bfm.teoritical.construct AGCTT——————————————— 780
*****

***********************************************************************
CLUSTAL 2.1 multiple sequence alignment

92BF.experimental.construct NNNCCNTAGTGACNNGNGATGCTGTNGNAANNGACGATACGNNNNCNNTN 250
92bf.teoretical.construct ———–ACG—TATACTGTTG—–GTCTTAACG——— 22
**. **.****.* *:* ::***

92BF.experimental.construct NNNTNACGTANCCCNGTNATGTTATTTAAAGNGAATGTNNGAGGGATTNG 300
92bf.teoretical.construct ———TAACCAGTAATGTTATTTAAAGTGAATGTATGAGGGATTCG 63
: .** ** *************.****** .******** *

92BF.experimental.construct ATGTTNAAAAATAAAATACTTAT-AATAG-TNTTTCNCTNTCAGNTATGA 348
92bf.teoretical.construct ATGTT-AAAAATAAAATACTTATTAATAGGTCTTTCACTGTCAGCTATGA 112
***** ***************** ***** * **** **.**** *****

92BF.experimental.construct GTTCATACTCACTAGNTGCAGCGGGGCCCACTNTAACCAAAGAACNGNCA 398
92bf.teoretical.construct GTTCATACTCACTAGCTGCAGCGGGGCCCACTCTAACCAAAGAACTGGCA 162
*************** **************** ************.*.**

92BF.experimental.construct TTAAATGTGCTTTNTNCTGCAGCTNNGGATGCAACTTGGGNTCCTCAGGA 448
92bf.teoretical.construct TTAAATGTGCTTTCTCCTGCAGCTCTGGATGCAACTTGGGCTCCTCAGGA 212
************* * ******** .************** *********

92BF.experimental.construct TAATTTANCATTATCCAATACTGGCGTTTCTAATACTTTGGTGGGTGTTT 498
92bf.teoretical.construct TAATTTAACATTATCCAATACTGGCGTTTCTAATACTTTGGTGGGTGTTT 262
******* ******************************************

92BF.experimental.construct TGACTCTTTCAAATACCAGTATTGATACAGTTAGCATTGCGAGTACAAAT 548
92bf.teoretical.construct TGACTCTTTCAAATACCAGTATTGATACAGTTAGCATTGCGAGTACAAAT 312
**************************************************

92BF.experimental.construct GTTTNTGATACATCTAAGAATGGTACAGTAACTTTTGCACATGANNCAAA 598
92bf.teoretical.construct GTTTCTGATACATCTAAGAATGGTACAGTAACTTTTGCACATGAGACAAA 362
**** ***************************************. ****

92BF.experimental.construct TAACTCTGCTAGCTTTGCCACCACCATTTCAACAGATAATGCCGTTGATG 648
92bf.teoretical.construct TAACTCTGCTAGCTTTGCCACCACCATTTCAACAGATAATGCCGTTGATG 412
**************************************************

92BF.experimental.construct GATTAAGCTGTACAAATTGTGCGGCCAAATTTGAACGGAATGTAAAAGAA 698
92bf.teoretical.construct GATTAAGCTGTACAAATTGTGCGGCCAAATTTGAACGGAATGTAAAAGAA 462
**************************************************

92BF.experimental.construct ATTGAGGGTGTAACAGAAGCTATTGTAAACTTTGGCGCATCAAAAATCAC 748
92bf.teoretical.construct ATTGAGGGTGTAACAGAAGCTATTGTAAACTTTGGCGCATCAAAAATCAC 512
**************************************************

92BF.experimental.construct GGTAACAGGTGAAGCAAACATTACGTTGGATAAAAATGCTGGAAATACGA 798
92bf.teoretical.construct GGTAACAGGTGAAGCAAACATTACGTTGGATAAAAATGCTGGAAATACGA 562
**************************************************

92BF.experimental.construct TTGTTAAAACTACAAATGGGAGTCAGTTGCCAACTAATTTACCACTTAAG 848
92bf.teoretical.construct TTGTTAAAACTACAAATGGGAGTCAGTTGCCAACTAATTTACCACTTAAG 612
**************************************************

92BF.experimental.construct TTTATTACCACTGAAGGTAACGAACATTTAGTTTCAGGTAATTACCGTGC 898
92bf.teoretical.construct TTTATTACCACTGAAGGTAACGAACATTTAGTTTCAGGTAATTACCGTGC 662
**************************************************

92BF.experimental.construct AAATATAACAATTACTTCGACAATTAAATAATTATATAATAGACGTAGCC 948
92bf.teoretical.construct AAATATAACAATTACTTCGACAATTAAATAATTATATAATAGACGTAGCC 712
**************************************************

92BF.experimental.construct TTCGAAATAAAGGCTACGTTGCTATCTTTATGTTTGTGATTTATAGGCAT 998
92bf.teoretical.construct TTCGAAATAAAGGCTACGTTGCTATCTTTATGTTTGTGATTTATAGGCAT 762
**************************************************

92BF.experimental.construct

پایان نامه
Previous Entries پایان نامه ارشد درباره 39BF.experimental.constract، 38-39MB.theoretical.costruct، 66-67Mbeta.teoretical.construc، 67BF.experimental.construct Next Entries پایان نامه ارشد درباره of، 107BF.experimental.construct، 107bf.teoretiical.construct، and