پایان نامه ارشد درباره **************************************************، 79.experimental.construct، 79.teoretical.construct، 67.teoretical.construct

دانلود پایان نامه ارشد

TTTATNGGCATCATTAAATAGTCAAGCTTATCCCGCAAGNNNNCCGGCAG 848
38.teoretical.construct TTTATAGGCATCATTAAATAGTCAAGCTT——————— 738
***** ***********************

********************************************************************

CLUSTAL 2.1 multiple sequence alignment

67.teoretical.construct ACGTATACTGTTGGTCTTAACGTAACCAGTAATGTTATTTAAAGTGAATG 50
67. ACGTATACTGTTGGTCTTAACGTAACCAGTAATGTTATTTAAAGTGAATG 50
**************************************************

67.teoretical.construct TATGAGGGATTCGATGTTAAAAATAAAATACTTATTAATAGGTCTTTCAC 100
67. TATGAGGGATTCGATGTTAAAAATAAAATACTTATTAATAGGTCTTTCAC 100
**************************************************

67.teoretical.construct TGTCAGCTATGAGTTCATACTCACTAGCTGCAGCGGGGCCCACTCTAACC 150
67. TGTCAGCTATGAGTTCATACTCACTAGCTGCAGCGGGGCCCACTCTAACC 150
**************************************************

67.teoretical.construct AAAGAACTGGCATTAAATGTGCTTTCTCCTGCAGCTCTGGATGCAACTTG 200
67. AAAGAACTGGCATTAAATGTGCTTTCTCCTGCAGCTCTGGATGCAACTTG 200
**************************************************

67.teoretical.construct GGCTCCTCAGGATAATTTAACATTATCCAATACTGGCGTTTCTAATACTT 250
67. GGCTCCTCAGGATAATTTAACATTATCCAATACTGGCGTTTCTAATACTT 250
**************************************************

67.teoretical.construct TGGTGGGTGTTTTGACTCTTTCAAATACCAGTATTGATACAGTTAGCATT 300
67. TGGTGGGTGTTTTGACTCTTTCAAATACCAGTATTGATACAGTTAGCATT 300
**************************************************

67.teoretical.construct GCGAGTACAAATGTTTCTGATACATCTGTTGATGGATTAAGCTGTACAAA 350
67. GCGAGTACAAATGTTTCTGATACATCTGTTGATGGATTAAGCTGTACAAA 350
**************************************************

67.teoretical.construct TTGTGCGGCCAAATTTGAACGGAATGTAAAAGAAATTGAGGGTGTAACAG 400
67. TTGTGCGGCCAAATTTGAACGAAATGTAAAAGAAATTGAGGGTGTAACAG 400
*********************.****************************

67.teoretical.construct AAGCTATTAAGAATGGTACAGTAACTTTTGCACATGAGACAAATAACTCT 450
67. AAGCTATTAAGAATGGTACAGTAACTTTTGCACATGAGACAAATAACTCT 450
**************************************************

67.teoretical.construct GCTAGCTTTGCCACCACCATTTCAACAGATAATGCCAACATTACGTTGGA 500
67. GCTAGCTTTGCCACCACCATTTCAACAGATAATGCCAACATTACGTTGGA 500
**************************************************

67.teoretical.construct TAAAAATGCTGGAAATACGATTGTTAAAACTACAAATGGGAGTCAGTTGC 550
67. TAAAAATGCTGGAAATACGATTGTTAAAACTACAAATGGGAGTCAGTTGC 550
**************************************************

67.teoretical.construct CAACTAATTTACCACTTAAGTTTATTACCACTGAAGGTAACGAACATTTA 600
67. CAACTAATTTACCACTTAAGTTTATTACCACTGAAGGTAACGAACATTTA 600
**************************************************

67.teoretical.construct GTTTCAGGTAATTACCGTGCAAATATAACAATTACTTCGACAATTAAATA 650
67. GTTTCAGGTAATTACCGTGCAAATATAACAATTACTTCGACAATTAAATA 650
**************************************************

67.teoretical.construct ATTATATAATAGACGTAGCCTTCGAAATAAAGGCTACGTTGCTATCTTTA 700
67. ATTATATAATAGACGTAGCCTTCGAAATAAAGGCTACGTTGCTATCTTTA 700
**************************************************

67.teoretical.construct TGTTTGTGATTTATAGGCATCATTAAATAGTCAAGCTT 738
67. TGTTTGTGATTTATAGGCATCATTAAATAGTCAAGCTT 738
**************************************
********************************************************
CLUSTAL 2.1 multiple sequence alignment

79.experimental.construct AATGGACGATAANGTATNCTGTTGGTCTTAACGTAAMCCAGTAATGTTAT 200
79.teoretical.construct ———–ACGTATACTGTTGGTCTTAACGTAA-CCAGTAATGTTAT 38
* **** ****************** *************

79.experimental.construct TTAAANGTGNAATGTATGAGGGNATTCGATGTTAAAAANAAAAATACTTA 250
79.teoretical.construct TTAAA-GTG-AATGTATGAGGG-ATTCGATGTTAAAAA-TAAAATACTTA 84
***** *** ************ *************** :**********

79.experimental.construct TTAATAGGTCTTTCACTGTCAGCTANNAGTTCATACTCACTAGCTGCAGN 300
79.teoretical.construct TTAATAGGTCTTTCACTGTCAGCTATGAGTTCATACTCACTAGCTGCAGC 134
*************************..**********************

79.experimental.construct GGGGCCCACTCTAACCAANGAACTGGCATTAAATGTGCTTTCTCCTGCAG 350
79.teoretical.construct GGGGCCCACTCTAACCAAAGAACTGGCATTAAATGTGCTTTCTCCTGCAG 184
****************** *******************************

79.experimental.construct CTCTGGATGCAACTTNGGCTCCTCAGGATAATTTAACATTATCCAATACT 400
79.teoretical.construct CTCTGGATGCAACTTGGGCTCCTCAGGATAATTTAACATTATCCAATACT 234
***************.**********************************

79.experimental.construct GGCGTTTCTAATACTTTGGTGGGTGTTTTGACTCTTTCAAATACCAGTAT 450
79.teoretical.construct GGCGTTTCTAATACTTTGGTGGGTGTTTTGACTCTTTCAAATACCAGTAT 284
**************************************************

79.experimental.construct TGATACAGTTAGCATTGCGAGTACAAATGTTTNTGATACATCTAAGAATG 500
79.teoretical.construct TGATACAGTTAGCATTGCGAGTACAAATGTTTCTGATACATCTAAGAATG 334
******************************** *****************

79.experimental.construct GTACAGTAACTTTTGCACATGAGACAAATAACGTTGATGGATTAAGCTGT 550
79.teoretical.construct GTACAGTAACTTTTGCACATGAGACAAATAACGTTGATGGATTAAGCTGT 384
**************************************************

79.experimental.construct ACAAATTGTGCGGCCAAATTTGAACGGAATGTAAAAGAAATTGAGGGTGT 600
79.teoretical.construct ACAAATTGTGCGGCCAAATTTGAACGGAATGTAAAAGAAATTGAGGGTGT 434
**************************************************

79.experimental.construct AACAGAAGCTATTNNNNCNAGCTTTGCCACCACCATTTCAACAGANAANG 650
79.teoretical.construct AACAGAAGCTATTTCTGCTAGCTTTGCCACCACCATTTCAACAGATAATG 484
*************. ..*.**************************.**.*

79.experimental.construct CCAACATTACGTTGGATAAAAATGCTGGAAATACGATTGTTAAAACTACA 700
79.teoretical.construct CCAACATTACGTTGGATAAAAATGCTGGAAATACGATTGTTAAAACTACA 534
**************************************************

79.experimental.construct AATGGGAGTCAGTTGCCAACTAATTTACCACTTAAGTTTATTACCACTGA 750
79.teoretical.construct AATGGGAGTCAGTTGCCAACTAATTTACCACTTAAGTTTATTACCACTGA 584
**************************************************

79.experimental.construct AGGTAACGAACATTTAGTTTCAGGTAATTACCGTGCAAANATAACAATTA 800
79.teoretical.construct AGGTAACGAACATTTAGTTTCAGGTAATTACCGTGCAAATATAACAATTA 634
***************************************.**********

79.experimental.construct CTTCGACAATTAAATAATTATATAATAGACGTAGCCTTCGAAATAAAGGC 850
79.teoretical.construct CTTCGACAATTAAATAATTATATAATAGACGTAGCCTTCGAAATAAAGGC 684
**************************************************

79.experimental.construct TACGTTGCTATCTTTATGTTTGTNNTTTNNNNNCATCATTAAATAGTCAA 900
79.teoretical.construct TACGTTGCTATCTTTATGTTTGTGATTTATAGGCATCATTAAATAGTCAA 734
***********************. *** . ..*****************

79.experimental.construct GCTTATCCCGCAAGAGGCCCGGCAGTACCGGCATAACCAAGCCTATGCNN 950
79.teoretical.construct GCTT———————————————- 738
****
********************************************************************

CLUSTAL 2.1 multiple sequence alignment

79m.experimental.construct NCGATANGTATACTGTTGGTCTTNAANGNTACCCNGTAATGTTATTTNAA 200
79.teroretical.construct —–ACGTATACTGTTGGTCTTAACG–TAACCAGTAATGTTATTT-AA 42
* **************** *.. **.** ************ **

79m.experimental.construct AGTGAATGTATGANGGNTTNGNTGTTTAAAAATAAAATACTTATTAATAG 250
79.teroretical.construct AGTGAATGTATGAGGGATTCGATG-TTAAAAATAAAATACTTATTAATAG 91
*************.** ** * ** *************************

79m.experimental.construct NTCTTTCNNNGTCAGCTATGAGTTCATACTCACTAGCTGCAGNNGGNCCC 300
79.teroretical.construct GTCTTTCACTGTCAGCTATGAGTTCATACTCACTAGCTGCAGCGGGGCCC 141
.****** .******************************** .**.***

79m.experimental.construct ACTCTANCCAAAGAACNGGCATTAAANGTGCTTTCTCCTGCAGNTCTGGA 350
79.teroretical.construct ACTCTAACCAAAGAACTGGCATTAAATGTGCTTTCTCCTGCAGCTCTGGA 191
****** *********.*********.**************** ******

79m.experimental.construct TGCAACTTGGGCTCCTCAGGATAATTTANNATTATCCAANACTGGCGTTT 400
79.teroretical.construct TGCAACTTGGGCTCCTCAGGATAATTTAACATTATCCAATACTGGCGTTT 241

پایان نامه
Previous Entries پایان نامه ارشد درباره  ،    N،    -، T  Next Entries پایان نامه ارشد درباره 92.teoreical.construct، 92.experimental.construct، 107.teoretical.construct، 107.experimental.construct