منبع مقاله درباره تمرین تناوبی، گروه کنترل، انحراف معیار، آزمون ویلکاکسون

دانلود پایان نامه ارشد

نمونههای عضلات استخراج شده از موشهای صحرایی که در فریزر 80- آزمایشگاه دانشکده تربیت بدنی و علوم ورزشی نگهداری میشدند توسط تانک ازت به فریزر 80- پژوهشکده غدد و متابولیسم انتقال داده شدند.

3-11-2- استخراج 54RNA
استخراج RNA با استفاده از روش RNX و با استفاده از محلول RNX- Plus شرکت سینا ژن (cat. N0 RN7713C) طبق پروتکل زیر انجام گرفت:
1- افزودن 1 میلیلیتر محلول RNX به 5 – 15 میلیگرم از بافت
2- هموژناسیون در دستگاه هموژنایزر55 (5 دقیقه با سرعت 30)
3- انکوباسیون در دمای اتاق به مدت 5 دقیقه
4- افزودن 200 میکرولیتر کلروفرم56 و سر و ته کردن با دست
5- قرار دادن روی یخ به مدت 5 دقیقه
6- سانتریفیوژ به مدت 15 دقیقه با دور 12000 در دمای 4 درجه سانتیگراد
7- انتقال فاز رویی به میکروتیوب جدید (حجم برداشته شده باید مشخص باشد)
8- افزودن حجم مساوی ایزوپروپانول57 و سر و ته کردن با دست
9- قرار دادن روی یخ به مدت 15 دقیقه
10- سانتریفیوژ به مدت 15 دقیقه با دور 12000 در دمای 4 درجه سانتیگراد
11- خارج کردن مایع رویی و نگه داشتن تهنشین
12- افزودن 1 میلیلیتر اتانول 75% و ورتکس کوتاه
13- سانتریفیوژ به مدت 8 دقیقه با دور 7500 در دمای 4 درجه سانتیگراد
14- خارج کردن مایع رویی و برگرداندن میکروتیوبها روی دستمال خشک
15- افزودن 40 – 50 میکرولیتر آب مقطر DNase (DW)
RNA استخراج شده سریعا به فریزر 80- انتقال داده شد. قبل از آن با استفاده از دستگاه اسپکتوفوتومتر58 غلظت RNA استخراج شده تعیین گردید.

3-11-3- واکنش رونویسی معکوس59 برای سنتز cDNA
واکنش رونویسی برای ساخت رشته اول cDNA انجام میشود. برای انجام این واکنش از پروتکل زیر استفده شد:
1- تهیه مخلوط زیر به ازای هر نمونه RNA :
• 1 میکرولیتر بافر DNase I
• 1 میکرولیتر آنزیم DNase I
• 0.25 میکرولیتر آنزیم Ribolock RNase Inhibitor
2- افزودن 1- 5 میکرولیتر از نمونه RNA که بر اساس غلظت به دست آمده متغیر است. (در اینجا بنا به فرمول: (غلظت RNA بنا به ng/µl / 1000) به دست آمد.)
3- افزودن آب فاقد نوکلئاز (DW) تا رسیدن به حجم 10 میکرولیتر
4- انکوباسیون در دمای 37 درجه سانتیگراد
5- افزودن 1 میکرولیتر EDTA
6- انکوباسیون در دمای 65 درجه سانتیگراد به مدت 10 دقیقه
7- افزودن 1 میکرولیتر Random Hexamer (pmol 100)
8- انکوباسیون در دمای 70 درجه سانتیگراد به مدت 5 دقیقه
9- تهیه مخلوط دوم به ازای هر نمونه RNA:
• 4 میکرولیتر بافر RT
• 2 میکرولیتر dNTP mix 10 mM
• 0.5 میکرولیتر آنزیم Ribolock RNase Inhibitor
• 0.5 میکرولیتر آب فاقد نوکلئاز
10- انکوباسیون در دمای 25 درجه سانتیگراد به مدت 5 دقیقه
11- افزودن 1 میکرولیتر آنزیم RT (RevertAid Reverse Transcriptase)
12- انکوباسیون در دمای 25 درجه سانتیگراد به مدت 10 دقیقه
13- انکوباسیون در دمای 42 درجه سانتیگراد به مدت 60 دقیقه
14- انکوباسیون در دمای 70 درجه سانتیگراد به مدت 10 دقیقه
سپس cDNA حاصل را ابتدا دستگاه اسپکتوفوتومتر غلظت آن را به دست میآوریم و بعد در دمای 20- درجه سانتیگراد نگهداری میکنیم.

3-11-4- Real Time PCR
در این پژوهش از روش کمی-مقایسهای Real time ∆CT با استفاده از رنگآمیزی SYBR-Green برای تعیین میزان بیان mRNA ژن FOXO1، MHC I، MHC IIa، MHC IIx و MHC IIb موشهای صحرایی نژاد اسپراگ داولی استفاده شد. به منظور مقایسه کیفی و کمی در میزان بیان ژنهای مذکور، از بیان ژن GAPDH به عنوان ژن کنترلی60 استفاده شد.
مواد و وسایل مورد استفاده:
– کیت مخلوط اصلی Maxima SYBR Green/ROX qPCR شرکت Thermo Scientific با غلظت X2 ( که شامل (Maxima Hot Start Taq DNA Polymerase، Maxima SYBR Green qPCR Buffer، SYBR Green I، ROX Passive reference dye و dUTP) بعلاوه آب فاقد نوکلئاز (DW)
– الگوی DNA
– پرایمرهای مناسب (جدول )
– دستگاه مورد استفاده، دستگاه Rotor gene 6000 شرکت Qurbet
جدول3-1- طراحی پرایمرهای ژنهای مورد نظر
نام پرایمر
توالی آغازگر ( َ5 به َ3)
طول قطعه
(مستقیم) MHC I
GGCCTGAATGAAGAGTAGAT
20
(معکوس) MHC I
GTGTTTCTGCCTAAGGTGCT
20
(مستقیم) MHC IIa
ATGACAACTCCTCTCGCTTTGG
22
(معکوس) MHC IIa
TTAAGCTGGAAAGTGACCCGG
21
(مستقیم) MHC IIx
CCAATGAGACTAAGACGCCTGG
22
(معکوس) MHC IIx
GCTATCGATGAATTGTCCCTCG
22
(مستقیم) MHC IIb
GAACACGAAGCGTGTCATCCA
21
(معکوس) MHC IIb
AGGTTTCGATATCTGCGGAGG
21
(مستقیم) FOXO1
TCCTCGAACCAGCTCAAACG
20
(معکوس) FOXO1
GGCGGTGCAAATGAATAGCAAG
22
(مستقیم) GAPDH
TGCCGCCTGGAGAAACCTGC
20
(معکوس) GAPDH
TGAGAGCAATGCCAGCCCCA
20

روش انجام کار:
با توجه به غلظت cDNA های سنتز شده، برای استفاده از cDNA از غلظت 20 در حجم 20 آن استفاده شد. سپس غلظت مناسب برای پرایمرها نیز به دست آمد. و در آخر مخلوط مطابق جدول 3-2 در حجم 15 میکرولیتر آماده شد تا در دستگاه قرار گیرد. لازم به ذکر است که برای کنترل درونی هر نمونه در هر ژن، دو مخلوط یکسان برای هر نمونه آماده شد تا در دستگاه قرار گیرد تا خطا را کاهش دهد. همچنین برای اطمینان از وجود نداشتن آلودگی در هر بار کار با دستگاه برای هر ژن مخلوطی که فاقد cDNA بود آماده میشد تا در دستگاه قرار گیرد. بعلاوه برای کنترل صحت نتایج، یکی از ژنهای عضله اسکلتی به نام GAPDH به عنوان ژن کنترل انتخاب گردید. سپس دستگاه در حالت SYBR Green قرار گرفت و تحت شرایط جدول3-3 واکنش صورت پذیرفت.
جدول 3-2- میزان مواد مورد نیاز برای یک واکنش Real time PCR در حجم 15 میکرولیتر
ماده ژن
MHC I
MHC IIa
MHC IIx
MHC IIb
FOXO1
Master Mix
5/7
5/7
5/7
5/7
5/7
پرایمر (مستقیم)
5/0
7/0
6/0
6/0
8/0
پرایمر (معکوس)
5/0
7/0
6/0
6/0
8/0
cDNA
1
1
1
1
1
آب فاقد نوکلئاز (DW)
5/5
1/5
3/5
3/5
9/4
ژن
MHC I
MHC IIa
MHC IIx
MHC IIb
FOXO1
چرخه
مرحله
مدت
دما ̊C
مدت
دما ̊C
مدت
دما ̊C
مدت
دما ̊C
مدت
دما ̊C
1
واسرشتسازی اولیه
10 دقیقه
95
10دقیقه
95
10دقیقه
95
10 دقیقه
95
10 دقیقه
95
40
تکثیر
15 ثانیه
95
15 ثانیه
95
15 ثانیه
95
15 ثانیه
95
30ثانیه
95

30 ثانیه
55
30 ثانیه
58
60 ثانیه
58
60 ثانیه
58
30ثانیه
58

30 ثانیه
72
30 ثانیه
72
30 ثانیه
72
30 ثانیه
72
45ثانیه
72
1
منحنی ذوب
5 دقیقه
72
5 دقیقه
72
5 دقیقه
72
5 دقیقه
72
5دقیقه
72

جدول 3-3- تنظیمات دستگاه برای انجام واکنش Real time PCR
3-12- وسایل وابزار اندازهگیری
3-12-1- وسایل و ابزار اندازهگیری کار با حیوانات
1- تردمیل جوندگان 5 لاین (طول مسیر نوار گردان 70 سانتیمتر- دارای شوک الکتریکی قابل تنظیم – حداقل سرعت 5 متر بر دقیقه و حداکثر 80 متر بر دقیقه با دقت 1 متر بر دقیقه – شیب قابل تنظیم از 25- تا 25+) ساخت شرکت دانش سالار ایرانیان
2- دستگاه تصفیه هوا
3- دماسنج و رطوبتسنج
4- دستگاه بخور سرد
5- داروی بیهوشی کتامین61 10% (در هرمیلیلیتر 100 میلیگرم کتامین) و زایلوزین62 2% (در هر میلیلیتر 20 میلیگرم زایلوزین)
6- ترازوی وزنکشی حیوانات
7- ترازوی با حساسیت 0.0001 جهت اندازهگیری وزن عضلات آزمودنیها
8- نیتروژن مایع به منظور بلافاصله منجمد کردن نمونههای عضلانی
9- تیغ بیستوری (جراحی) سایز 11
10- سرنگ انسولینی برای تزریق ماده بیهوشی به آزمودنیها
11- سرنگ 10 میلی لیتری به منظور خونگیری از قلب آزمودنیها
12- کرایوتیوب 2 میلی لیتری DNA-RNase free، ساخت شرکت گرینر به منظور نگهداری نمونه عضلات

3-12-2- وسایل و ابزار اندازهگیری آزمایشهای سلولی مولکولی
1- دستگاه Rotor-Gene 6000 ساخت شرکت Qurbet به منظور انجام Real time PCR
2- سانتریفیوژ یخچال دار
3- دستگاه هموژنایزر
4- دستگاه PCR
5- کیت Real time PCR (Maxima SYBR Green/ROX qPCR) ساخت شرکت Thermo Scintific
6- کیت مستر میکس PCR (Top High fidelity PCR) ساخت شرکت توپاز ژن کاوش
7- آنزیم و بافر RevertAid Reverse Transcriptase ساخت شرکت Thermo Scintific به منظور سنتز cDNa
8- dNTP Mix 10mM ساخت شرکت Thermo Scintific به منظور سنتز cDNA
9- RiboLock RNase Inhibitor 20u ساخت شرکت Thermo Scintific به منظور سنتزcDNA
10- Random Hexamer 100pmol ساخت شرکت ThermoScintific به منظور سنتز cDNA
11- آنزیم و بافر DNase I ساخت شرکت Thermo Scintific به منظور سنتز cDNA
12- محلول RNX-Plus ساخت شرکت سیناژن به منظور استخراج RNA از بافت عضلانی

3-13- روش آماری
از آمار توصیفی برای دسته بندی دادههای خام و تنظیم جدولها و از برنامههای excel و Prism 6 برای تنظیم نمودارها و انجام محاسبات استفاده شد. از روش CT∆∆ برای محاسبه میزان افزایش یا کاهش بیان ژن هدف در گروه تمرین نسبت به گروه گروه کنترل استفاده شد. از آزمون شپیرو-ویلک63 برای تست نرمال بودن دادهها استفاده شد، که در صورت نرمال بودن دادهها از آزمون T و در غیر اینصورت از آزمون ویلکاکسون-مان-ویتنی64 برای تعیین معنی داری فرض صفر استفاده شد. از نرمافزار 16 Spss برای انجام تست های معنی داری به کار برده شد.

3-14 روش ∆∆CT
دادههای Real time PCR به دو روش قطعی و نسبی اندازهگیری میشوند. روش نسبی برای اکثر مطالعات فیزیولوژیکی و پاتولوژیکی مناسب است و به مقایسه بیان ژن هدف با ژن مرجع و بیان ژن مشابه در نمونه هدف در مقابل نمونه مرجع میپردازد. دو مدل ریاضی برای انجام این مقایسه وجود دارد: مدل کارایی کالیبرهشده و مدل ∆∆CT . فرمول ریاضی مدل ∆∆CT برابر است با :
∆∆CT-2
∆∆CT=∆Ct test sample – ∆Ct calibrator sample
∆Ct= CTtarget – CTreference
که بیانگر میزان هدف است که نسبت به مرجع درونی و کالیبراتور نرمال شده است(79, 80).
برای انجام آزمون ویلکاکسون-مان-ویتنی، ∆Ct های گروه تمرین و کنترل به عنوان داده برای انجام تست در نظر گرفته میشوند(79).

فصل چهارم
تجزیه و تحلیل آماری دادهها

4-1- مقدمه
در فصل پیشین نحوه انجام پژوهش و جمعآوری اطلاعات بیان گردید و مواردی از قبیل روش پژوهش، نمونه و جامعه آماری، محیط پژوهش، ابزارهای مورد استفاده در پژوهش، متغیرهای پژوهش، آشنایی با محیط پژوهش و نحوه انجام پروتکلهای تمرینی، نحوه نمونه گیری و استخراج عضلات مورد نظر، روش سنجش بیان ژن و روشهای آماری به اختصار بیان شد. در این فصل اطلاعات به دست آمده با استفاده از روشهای آماری تهیه و مورد تجزیه و تحلیل قرار گرفت. ابتدا اطلاعات خام دریافتی از آزمایشگاههای حیوانات و سلولی – مولکولی در جداول جداگانه تنظیم و سپس با استفاده از نرمافزار 16 Spss مورد بررسی و تجزیه و تحلیل قرار گرفتند.

4-2- تجزیه و تحلیل توصیفی یافتهها
در این قسمت نتایج توصیفی متغیرهای پژوهش در سه گروه کنترل، تمرین تناوبی سرعتی و تمرین اکسنتریک در قالب جداول و نمودار گزارش میشود.

4-2-1- وزن بدن
میانگین و انحراف معیار وزن بدن گروههای کنترل، تمرینی در قبل و بعد از دوره تمرین در جدول 4-1 آمده است. (با انجام آزمون شپیرو-ویلک مشخص شد که دادههای وزن نرمال هستند.)

جدول 4-1- میانگین و انحراف معیار (M±SD) وزن بدن (گرم) گروههای تمرینی و کنترل
گروه
وزن اولیه (گرم)
وزن نهایی (گرم)
کنترل
15±205
22±293
تمرین اکسنتریک
5±227
23±295
تمرین تناوبی سرعتی
11±234
22±280

شکل 4-1- تغییرات وزن بدن اولیه و نهایی گروههای تمرینی و کنترل
4-2-2- وزن عضله سولئوس و SVL
میانگین تغییرات وزن عضلات سولئوس و SVL در گروه تمرین اکسنتریک و گروه تمرین تناوبی سرعتی و گروه کنترل پس از دوره تمرینی در جدول 4-2 آورده شده است. همچنین وزن عضلات فوق به نسبت وزن بدن نمونهها نیز در جدول 4-3 آورده شده است. (در تمامی موارد ذکر

پایان نامه
Previous Entries منبع مقاله درباره فعالیت ورزشی، تمرین تناوبی، گروه کنترل، جامعه آماری Next Entries دانلود پایان نامه درباره محیط زیست، مصرف انرژی، اقتصاد ایران، توسعه مالی