منابع پایان نامه درباره ضریب همبستگی، متغیر مستقل، تحلیل داده

دانلود پایان نامه ارشد

نمونه‌های گیاهی مورد بررسی
استخراج DNA با استفاده از روش استخراج CTAB تغییر یافته بترتیب زیر انجام گرفت:
ابتدا بافر استخراج به مدت 20 الی 30 دقیقه، درون حمام آب گرم (بن ماری) با دمای 65 درجه سانتی‌گراد گذاشته شد.
حدود 2/0 گرم از نمونه برگی را در هاون چینی قرار داده و در حضور ازت مایع سریعاً پودر شدند. پودر حاصله درون میکروتیوب‌های 2 میلی‌لیتری ریخته شدند.
800 میکرولیتر بافر استخراج به هر کدام از میکروتیوب‌ها اضافه نموده و بعد از کمی مخلوط کردن با دستگاه ورتکس، در حمام آب گرم به مدت 65 دقیقه قرار داده شدند. در این مدت هر 10 دقیقه یک بار به آرامی تکان داده شدند تا پودر گیاهی بخوبی در بافر استخراج حل شده و تخریب سلول‌ها و استخراج DNA از پودر گیاهی تسهیل گردد.
سپس به مدت چند ثانیه در دمای اتاق (دمای معمولی) قرار گرفتند و با دست به آرامی تکان داده ‌شدند.
800 میکرولیتر-کلروفرم ایزوآمیل ( به میکروتیوب‌ها اضافه کرده و بعد از کمی تکان دادن به مدت 10 دقیقه با سرعت 12000 دور در دقیقه و در درجه حرارت اتاق سانتریفیوژ شدند. در این مرحله 3 فاز مجزا مشاهده شد که فاز بالایی به آرامی با استفاده از سمپلر 1 میلی لیتری برداشته شد و مجدداً در میکروتیوب‌های 2 میلی‌لیتری ریخته شدند. این مرحله دوباره تکرار گردید و فاز بالایی درون میکروتیوب‌های 5/1 میلی لیتری ریخته شد. این مرحله برای نمونه‌هایی که فاز بالایی شفافی نداشتند، تکرار گردید.
5/0 و 6/0 میلی‌لیتر از حجم فاز بالایی حاصل از مرحله قبل، به ترتیب آمونیوم استات 5/7% و ایزوپروپانول مطلق (100%) (نگهداری شده در فریزر 40- درجه سانتی‌گراد) به میکروتیوب‌ها اضافه شد و به آرامی تکان داده شد تا امولسیون کاملی مشاهده گردید. در پایان این مرحله معمولا کلاف DNA قابل دیدن بودند، ولی برای تشکیل کلاف کامل، امولسیون حاصله به مدت 20 دقیقه در فریزر 40- درجه سانتی‌گراد نگهداری شدند.
بعد از گذشت 10 دقیقه اول (از 20 دقیقه‌ای که باید در فریزر نگه‌داری شود)، سانتریفیوژ روشن شده و در دمای 4 درجه سانتی‌گراد تنظیم گردید تا در انتهای 20 دقیقه دمای سانتریفیوژ به 4 درجه برسد.
نمونه‌ها از فریزر بیرون آورده شده و با سرعت 10000 دور در دقیقه به مدت 10 دقیقه سانتریفیوژ شد و فاز مایع به آرامی خارج گردید تا کلاف در ته لوله باقی بماند.
کلاف باقیمانده با استفاده از اتانول مطلق (96%) شستشو داده شد و با سرعت 9500 دور در دقیقه به مدت 1 دقیقه سانتریفیوژ شد و سپس مایع رویی را دور ریخته و لولهها در هوای آزاد به مدت 30 دقیقه نگهداری شدند تا الکل به طور کامل بخار شده و کلاف DNA خشک شود.
30 میکرولیتر آب دو بار تقطیر به میکروتیوب‌ها اضافه شد و برای حل شدن کلاف، میکروتیوب‌ها تا زمان استفاده در یخچال 4 درجه سانتی‌گراد قرار داده شدند.

3-6-2- بررسی کمیت و کیفیت DNA
3-6-2-1- بررسی کمیت DNA به روش اسپکتروفتومتری
راحتترین روش بررسی کیفیت و غلظت DNA، استفاده از اسپکتروفتومتر است. حداکثر جذب نوری اسیدهای نوکلئیک در طول موج 260 نانومتر است. روش کار به این صورت بود که اگر اسید نوکلئیک (DNA یا RNA) در بافر TE یا آب مقطر حل شده باشد، ابتدا با محلول TE یا آب مقطر به عنوان شاهد دستگاه صفر یا کالیبره می‌شود. سپس
میزان جذب نمونه خوانده می‌شود. محلولی که نمونه در آن حل شده بایستی شفاف و یکنواخت باشد. بین غلظت DNA یا RNA و جذب نوری آن در 260 نانومتر رابطه زیر وجود دارد:
جذب برابر با یک معادل 40 میکروگرم در میلیلیتر RNA یا DNA تک رشتهای و 50 میکروگرم در میلیلیتر DNA دو رشتهای میباشد. شرط لازم در این موارد، آن است که کیفیت DNA استخراج شده (نسبت جذب در طول موج 260 به جذب در طول موج 280 ) بین 8/1-6/1 میکروگرم بر میلی لیتر و کیفیت RNA استخراج شده بین 2-8/1 میکروگرم در میلی لیتر باشد.

3-6-2-2- الکتروفورز ژل آگارز با دستگاه الکتروفورز افقی
در این تحقیق، جهت بررسی کیفیت DNA ژنومی از نظر شکستگی و قطعه قطعه شدن و بررسی DNA تکثیر شده حاصل از PCR، از ژل آگارز 1 درصد استفاده شد. به این منظور 1 گرم آگارز به 100 میلی لیتر بافر TBE(1X)68 اضافه کرده و تا زمان حل شدن در ماکروویو قرار داده شد. تانک الکتروفورز، شانه و صفحه نگهدارنده ژل69 با آب مقطر استریل شسته شدند. دو وجه آزاد صفحه ژل مسدود شده و صفحه ژل در سطح صاف و تراز ثابت قرارداده شد. محل شانه در صفحه ژل تنظیم گردید بطوریکه لبه پایینی شانه 1 میلیمتر از کف صفحه ژل فاصله داشته باشد. با توجه به حجم صفحه ژل، میزان معینی از آگارز توزین و ژل مربوطه تهیه شد. زمانی که ژل کمی خنک شد، درون صفحه ژل ریخته شد. بعد از سرد شدن و بستن ژل، شانه به آرامی بیرون کشیده شد. ژل درون تانک حاوی بافر TBE(1X) قرار گرفت. باید توجه کرد بافر مشابه و هم غلظت بافری باشد که برای تهیه ژل استفاده شده است. بافر باید حدود یک میلیمتر روی سطح ژل را بپوشاند. نمونهای که با بافر بارگذاری70 مخلوط شده است، درون چاهکهای ژل آگارز با دقت بارگذاری شد. محفظه پوشش تانک الکتروفورز بسته شده و جریان الکتریکی با ولتاژ 60 و به مدت 40 دقیقه برقرار گردید.

3-7- PCR
برای انجام واکنشPCR ، از دستور العمل ویلیامز71و همکاران (1990) با اندکی تغییرات استفاده شد. هر واکنش PCR شامل 25 میکرولیتر محتوی: 2 میکرولیتر DNA الگو با غلظت 50 نانوگرم تهیه شده، 5/1میکرولیتر MgCl2 با غلظت 50 میلی‌مولار، 5/0 میکرولیتر dNTP با غلظت 10 میلی‌مولار، 3/0 میکرولیتر آنزیمTaq DNA polymerase با غلظت lµunit/ 5، 2/1 میکرولیتر آغازگر با غلظت ppm 10، 5/2 میکرولیتر Buffer PCR دارای غلظت x10 و 18 میکرولیتر آب دو بار تقطیر استریل بود. در این تحقیق از تعداد 10 جفت آغازگر ساخته شده توسط از شرکت تکاپو زیست استفاده شد. آغازگرهای SSR طبق فرمول مربوط به هر یک که شرکت تولیدکننده روی هرکدام ذکر کرده رقیق شدند و در دمای 40- درجه سانتیگراد نگهداری شدند. آغازگرهای مورد استفاده در این پایان نامه با بررسیهای انجام شده در بانک ژن و مرور مقالات بر اساس تعداد باندها، طراحی و انتخاب گردیدند (شیزاد72 و همکاران، 2009). جدول 3-4 اسامی آغازگرها و توالی آنها را نشان میدهد.
برای انجام واکنش PCR ابتدا یک مخلوط اولیه73 از تمامی مواد PCR (به جز DNA) بر اساس تعداد واکنش ها با در نظر گرفتن یک کنترل منفی (بدون DNA) تهیه گردید. تهیه مخلوط اولیه این مزیت را دارد که موجب کاهش خطاهای مربوط به پیپت نمودن حجم‌های کم می‌شود. سپس آنزیمTaq DNA polymerase را اضافه کرده و به هم زده می‌شود. پس از آن با تقسیم مخزن مخلوط ذخیره براساس تعداد نمونه مورد بررسی، تکثیر PCR انجام می‌شود.

جدول 3- 4: فهرست آغازگرهای استفاده شده و توالی آنها
Size range
توالی آغازگر برگشت
توالی آغازگر رفت
نام آغازگر
280-320
GCGAAATTATTTTGAAATGGAGTTGA
AGCAAGAAGAAGGCAAGAAGAAGG
Xtxp270
160-245
TATTCATCGAGCAAAAGGCA
TATTTCCTCTTGAAAGAATCAGGG
Xtxp335
247-320
ACTCTACTCCTTCCGTCCACAT
GAAATTACAATGCTACCCCTAAAAGT
Xtxp274
180-240
ACC CAT TAT TGA CCG TTG AG
TCT CAA GGT TTG ATG GTT GG
Xtxp20
130-154
GCCTTTTTCTGAGCCTTGA
TGGGCAGGGTATCTAACTGA
Xtxp354
90-185
GTGAACTATTCGGAAGAAGTTTGGAGGAAA
CAGGAAAATACGATCCGTGCCAAGT
Xtxp312
170-280
AGTATAATAACATTTTGACACCCA
AACGGTTATTAGAGAGGGAGA
Xtxp331
330-360
AGTATAATAACATTTTGACACCCA
GCAAGCGAGCTGACTTATGTAACGAGA
Xtxp287
180-225
GCTTAGTGTGAGCGCTGACCAG
CACCAAGTGTCGCGAACTGAA
Xtxp258
205-260
TTGTCATTTCCCCCTTCTTTCTTTT
ATTTGATTCTTCTTGCTTTGCCTTGT
Xtxp285

3-7-1- الگوی دمایی
براي آغازگرهای با دماي اتصال 56 تا 66 درجه سانتی‌گراد، برنامه PCR به‌صورت شیب حرارتی تنظیم گردید (هکر 74و روکس، 1996). الگوی دمایی مورد استفاده در این تحقیق در جدول3-5 آمده است. پس از اتمام واکنش، نمونه‌ها را از دستگاه خارج کرده و در فریزر در دمای 40- درجه سانتی‌گراد نگهداری شدند.

جدول 3-5- الگوی دمای PCR در آزمایش
سیکل‌ها
دما(°C)
زمان
تعداد سیکل
واسرشت سازی DNA
94
5 دقیقه

تک رشته‌ای شدن DNA
94
30 ثانیه

اتصال آغازگرها
66-56
60 ثانیه
35
گسترش رشته‌ها
72
45 ثانیه

تکمیل گسترش رشته‌ها
72
7 دقیقه
1

3-7-2- امتیازبندی داده‌های مولکولی و تجزیه و تحلیل‌های آماری آن‌ها:
الگوی نواری حاصل براساس وجود یا عدم وجود نوار به ترتیب، به صورت یک و صفر امتیازدهی75 شد. سپس بر اساس ماتریس صفر و یک، فاصله یا شباهت ژنتیکی بین افراد با استفاده از ضرایب مختلف محاسبه گردید. مقدار عددی ضرایب تشابه بین صفر و یک است که مقدار صفر، بیانگر عدم وجود نوارهای مشترک (عدم شباهت ژنتیکی) و مقدار یک، بیانگر الگوهای نواری یکسان (تشابه ژنتیکی کامل) است. دادههای این ماتریس سپس توسط نرمافزارهای76NTSYS 2.02e و PopGene 1.3277 مورد تجزیه قرار گرفتند. قبل از هر کار آزمون منتل78 برای گزینش مناسب‌ترین ماتریس تشابه از میان ضرایب تشابه دایس، جاکارد و تطابق ساده انجام گردید و هر کدام که بالاترین ضریب همبستگی کوفنتیکی را دارا بود، برای گروه‌بندی ژنوتیپ‌ها انتخاب شد. تجزیه خوشه‌ای ژنوتیپ‌های مورد مطالعه با استفاده از ماتریس تشابهی که دارای بالاترین ضریب کوفنتیکی بود به روش‌های مختلف تجزیه خوشه‌ای صورت پذیرفت. جهت بررسی ارتباط بین نشانگرها و مهمترین ویژگی‌های تحمل به شوری از رابطه‌ غیر خطی لجستیک (مخصوص مشاهدات دو تایی) استفاده شد. در این رابطه که هم در شرایط بدون تنش و هم شرایط تنش انجام شد، مشاهدات مربوط به نشانگرها بعنوان متغیر تابع و سایر ویژگیها به عنوان متغیر مستقل در نظر گرفته شدند. شاخص‌هایي که براي ارزیابی تنوع ژنتیکی ژنوتیپ‌های سورگوم محاسبه شدند، شامل تعداد آلل‌ها در هر مکان ژنی، تعداد آلل‌هاي موثر، محتوای اطلاعات چندشکلی، شاخص شانون، هموزیگوسیتی و هتروزیگوسیتی قابل انتظار، هموزیگوسیتی و هتروزیگوسیتی مشاهده شده بودند.
3-7-2-1- محتوای اطلاعات چندشکلی
مقدار شاخص PIC، به صورت میانگینی از PICهای بدست آمده از تمامی باندهای آن نشانگر در کل جمعیت و در گروه‌های تفکیکی، با استفاده از رابطه زیر محاسبه شد (بوتستین79، 1980).

PICij= 1-Σ (Pij2)
Pij = فراوانی j امین آلل از i امین نشانگر

3-7-2-2- محاسبه تعداد آلل مشاهده شده (Na) و تعداد آلل مؤثر (Ne)
تعداد آلل‌های مشاهده شده و تعداد آلل‌های مؤثر، براساس روش کیمورا و کراو80 (1964) و همچنین هتروزایگوسیتی مورد انتظار با استفاده از روش لون81 (1949)، با استفاده از نرم‌افزار Popgene 1.32، برای تمامی ژنوتیپ‌های مورد مطالعه محاسبه شدند.

3-7-2-3- محاسبه تنوع ژنوتیپی
تنوع ژنتیکی بر اساس شاخص اطلاعاتی شانون به روش لوونتین82 (1972) و با استفاده از نرم‌افزار Popgene 1.32 برای تمامی ژنوتیپ‌های مورد مطالعه محاسبه شد.

I= – Σ Pi ln Pi
I = شاخص شانون
Pi= نسبت فراوانی درون گونه‌ای گروه i ام

3-7-2-4- تجزیه خوشه‌ای83
تجزیه خوشه‌ای، براساس ضریب جاکارد و به روش UPGMA در ارقام مورد مطالعه، انجام پذیرفت و گروهبندی براساس زمینه ژنتیکی آن‌ها صورت گرفت. کلیه مراحل تا رسم دندروگرام84 توسط نرم‌افزار NTSYS 2.02 انجام شد. جهت تأیید تجزیه خوشه‌ای، ضریب همبستگی کوفنتیک با استفاده از نرم‌افزار NTSYS 2.02 محاسبه شد.

3-7-2-5- تجزیه به مؤلفه‌های اصلی (PCA)
تجزیه به مؤلفه‌های اصلی برای داده‌های مولکولی با استفاده از نرم‌افزار NTSYS 2.02 انجام شد و نمودارهای دو بعدی برای دو مؤلفه اصلی با استفاده از همین نرم‌افزار رسم شد.

فصل چهارم
نتایج و بحث

4-1 – آزمایش اول : تجزیه و تحلیل داده‌ها در مرحله گیاهچهای
4-1-1- آمار توصیفی برآورد اجزاء واریانس، دامنه تغییرات، ضرایب تنوع و توارثپذیری عمومی صفات مورد بررسی
آمار توصیفی

پایان نامه
Previous Entries منابع پایان نامه درباره ضریب همبستگی، مواد معدنی، تجزیه واریانس Next Entries پایان نامه با کلید واژگان انتقال دانش، عصر اطلاعات